ID: 1075909930

View in Genome Browser
Species Human (GRCh38)
Location 10:126115433-126115455
Sequence CAGTCAGCTCGTTCTCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 157}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075909930_1075909937 20 Left 1075909930 10:126115433-126115455 CCACAGAGAGAACGAGCTGACTG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1075909937 10:126115476-126115498 TGCCCTTCGAGGGGCAGCCTGGG No data
1075909930_1075909933 9 Left 1075909930 10:126115433-126115455 CCACAGAGAGAACGAGCTGACTG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1075909933 10:126115465-126115487 CTGTTTCTCTGTGCCCTTCGAGG No data
1075909930_1075909935 11 Left 1075909930 10:126115433-126115455 CCACAGAGAGAACGAGCTGACTG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1075909935 10:126115467-126115489 GTTTCTCTGTGCCCTTCGAGGGG No data
1075909930_1075909934 10 Left 1075909930 10:126115433-126115455 CCACAGAGAGAACGAGCTGACTG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1075909934 10:126115466-126115488 TGTTTCTCTGTGCCCTTCGAGGG No data
1075909930_1075909936 19 Left 1075909930 10:126115433-126115455 CCACAGAGAGAACGAGCTGACTG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1075909936 10:126115475-126115497 GTGCCCTTCGAGGGGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075909930 Original CRISPR CAGTCAGCTCGTTCTCTCTG TGG (reversed) Intronic
904672272 1:32174716-32174738 CAGTCAGCCTGTTCTCCCTATGG - Exonic
907514948 1:54987964-54987986 CAGTCAGCCCTTTCTGTCTATGG + Intronic
907779024 1:57547589-57547611 CAGTCAACTCCCTGTCTCTGGGG - Intronic
909505131 1:76379620-76379642 GAGGCAGCTCTTTCTCTTTGTGG + Intronic
915517605 1:156422161-156422183 CAGTCATCTGGTTCTTTCTGAGG - Intronic
915902868 1:159858727-159858749 CACTCACCACGTTCTCTCGGTGG + Exonic
919395401 1:197040922-197040944 CAGTGAGCCATTTCTCTCTGTGG + Intronic
920984825 1:210876988-210877010 CTGTGAGCTCGTTATCTCTGAGG - Intronic
922539002 1:226404887-226404909 AGGTCAGTTCATTCTCTCTGTGG - Intronic
923507260 1:234615403-234615425 CTGTCAGCTCCTTTTGTCTGTGG - Intergenic
924121698 1:240806423-240806445 CAGCCAGCTCACTTTCTCTGAGG + Intronic
924661127 1:246018190-246018212 TACACAGCTCTTTCTCTCTGTGG + Intronic
1063198159 10:3762317-3762339 CACTCACCTTGTTCTCTATGGGG - Intergenic
1068492371 10:57739616-57739638 TCATTAGCTCGTTCTCTCTGAGG - Intergenic
1069173327 10:65260054-65260076 CAGTCATGTCTTTCTCTCTCTGG - Intergenic
1070195381 10:74151583-74151605 CAGCCAGCTCGGTCCCCCTGCGG - Intronic
1070572051 10:77647337-77647359 TCGCCAGCTCTTTCTCTCTGAGG + Intergenic
1071601125 10:86959204-86959226 CAGCCTGCCCCTTCTCTCTGGGG - Intronic
1072484001 10:95837129-95837151 CTGTCAGCTTGTTTTCTCTAAGG - Intronic
1072665172 10:97387546-97387568 CAGTCAGCTCTTTGTATGTGTGG - Intronic
1072703784 10:97665255-97665277 CATTCTTCTCGTTCTTTCTGAGG + Intronic
1074684840 10:115951261-115951283 TAGTCAGCTCATTCCCTCAGTGG + Intergenic
1075909930 10:126115433-126115455 CAGTCAGCTCGTTCTCTCTGTGG - Intronic
1077906655 11:6539598-6539620 CAGTCAGCTCGCACCCTCTGGGG - Intronic
1078527031 11:12109347-12109369 CAGTCAGCTTGTACTCTCAGAGG - Intronic
1079440602 11:20510623-20510645 CAGTCAGCTTGTTTTCACTATGG + Intergenic
1081265710 11:41018723-41018745 CTGTCAGCTCATTCCCACTGTGG - Intronic
1081366645 11:42243411-42243433 GAGTCAGGACATTCTCTCTGTGG + Intergenic
1081481591 11:43494753-43494775 ATGTCAGCTCCCTCTCTCTGAGG + Exonic
1082789275 11:57335883-57335905 TAGCCAGCTCATCCTCTCTGTGG - Intergenic
1084849759 11:71929224-71929246 TAGTCAGCTCCTTCCCTCTCAGG - Intronic
1085029598 11:73262867-73262889 CACTCTGCACGTTCTCCCTGGGG - Intergenic
1088160030 11:106857623-106857645 CAGTCAGCTCTCTGTATCTGTGG + Intronic
1089139158 11:116272480-116272502 CCATCAGCTCTTTGTCTCTGAGG - Intergenic
1090684375 11:129099802-129099824 CAGTCATCTTGGTCTCTCAGTGG - Intronic
1091529549 12:1340700-1340722 CAGTCAGCTCGGTTTCTCGCTGG + Intronic
1092893492 12:12991310-12991332 CAGTCAGCCCTTCCTGTCTGTGG - Intronic
1097920315 12:65065270-65065292 CAGGCAACTTGATCTCTCTGTGG - Intronic
1101524039 12:105511466-105511488 CAGTCATCTCCTTTTCTCTGAGG + Intergenic
1102288798 12:111682218-111682240 CAGCCAGCTCATTTTATCTGCGG - Intronic
1105040308 12:132956111-132956133 CAGCCAGCTCGTTCGCGCTGGGG + Intronic
1107789628 13:43988807-43988829 CAGTCAGCCCATATTCTCTGGGG - Intergenic
1107821988 13:44294523-44294545 CAGGTAGCATGTTCTCTCTGAGG - Intergenic
1109058619 13:57583169-57583191 CTCTCAGCTTTTTCTCTCTGAGG + Intergenic
1111254546 13:85648971-85648993 CAGTCTGTTCCTTCACTCTGTGG - Intergenic
1112683442 13:101794283-101794305 CAGTCAGCTCTCTTTCTCTACGG + Intronic
1112777131 13:102856651-102856673 CAGACAGGCAGTTCTCTCTGGGG + Intronic
1114265595 14:21070956-21070978 GAGGCAGCTCTTTTTCTCTGCGG - Intronic
1115882078 14:37930776-37930798 CAGTTTGCTTGTTCTTTCTGAGG - Intronic
1116561662 14:46387138-46387160 CAGTCAGCTCGTTTTGACAGAGG - Intergenic
1117535930 14:56703292-56703314 GAGTCAGCCCCTTCACTCTGGGG - Intronic
1118450958 14:65901777-65901799 CAGCCTGCTCCTGCTCTCTGTGG + Intergenic
1122997969 14:105275901-105275923 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997980 14:105275954-105275976 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122997993 14:105276007-105276029 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998004 14:105276060-105276082 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998079 14:105276378-105276400 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998144 14:105276643-105276665 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998167 14:105276749-105276771 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998218 14:105276961-105276983 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998271 14:105277173-105277195 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998284 14:105277226-105277248 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998309 14:105277332-105277354 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998334 14:105277438-105277460 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998347 14:105277491-105277513 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1122998358 14:105277544-105277566 CTCTCAGCTCCTTCTCACTGTGG - Intronic
1124450908 15:29789841-29789863 CAGAAAGCTTGTTCTCTCTGAGG - Intronic
1125124735 15:36206900-36206922 CAGTCAACTCTTTGTATCTGTGG - Intergenic
1126597015 15:50393061-50393083 CAGTCAAATTCTTCTCTCTGAGG + Intergenic
1129631626 15:77266889-77266911 GAGTCAGCTTGTTTTCTCAGTGG + Intronic
1130377936 15:83346676-83346698 CCATCAGCTCCTCCTCTCTGGGG + Intergenic
1132540431 16:505907-505929 CAGTCAGTTCCTCCTCTGTGTGG - Intronic
1133499176 16:6349119-6349141 CAGTAACCTCTGTCTCTCTGAGG + Intronic
1137290710 16:47050266-47050288 CAGTCAGCTCCTTCTCTGGAAGG + Intergenic
1137731990 16:50696224-50696246 CAGCCAGCCCGGTTTCTCTGGGG - Intronic
1138244987 16:55460720-55460742 CACTCAGCTCTTTCTCCCTGCGG - Intronic
1140700818 16:77580116-77580138 CAATCACCTCCTGCTCTCTGGGG - Intergenic
1141527257 16:84619026-84619048 GAGTCAGCTCGTGCTTTCAGAGG - Intergenic
1143655826 17:8293018-8293040 AAGTCAGCTCGATACCTCTGTGG - Intronic
1144819192 17:18059522-18059544 CAGTCAGGTGGGGCTCTCTGAGG - Intronic
1146183374 17:30710429-30710451 CAGGCAGCACCTTCTCTCCGTGG + Intergenic
1146834909 17:36102988-36103010 CAGTCAACGGGTTCTCTTTGTGG + Intergenic
1147891320 17:43719344-43719366 CATTGAGCATGTTCTCTCTGAGG + Intergenic
1149419199 17:56492101-56492123 CATTCAACTTGTTTTCTCTGAGG + Intronic
1150221217 17:63496918-63496940 CATGCAGCTCGTTCTCCGTGCGG - Exonic
1153950913 18:10056954-10056976 CCATCAGCCTGTTCTCTCTGGGG + Intergenic
1155417606 18:25616783-25616805 CACTCAGCTGACTCTCTCTGCGG - Intergenic
1157915849 18:51663006-51663028 CAGTCATCTGTCTCTCTCTGCGG + Intergenic
1161106927 19:2448350-2448372 CAGTCAGCTCTCTCTCTGTGGGG - Intronic
1162117745 19:8441802-8441824 CAATCAGCTCCTCCACTCTGAGG - Intronic
1163138858 19:15332685-15332707 CAGCCCGCTCCTTCGCTCTGCGG - Intergenic
1165890933 19:39111873-39111895 CAGCCAGCTCTTTCTCACTGCGG + Intergenic
1167580231 19:50337016-50337038 CAGTCAGCTTGTCCTCACTCAGG + Intronic
1167583798 19:50361662-50361684 CAGTCAGCTTGTCCTCGCTCAGG + Exonic
1168433951 19:56302939-56302961 CGGTGATCTGGTTCTCTCTGTGG - Intronic
927682993 2:25152331-25152353 CAGTCAGATCATGCTCACTGTGG + Intronic
929053409 2:37856584-37856606 CAGTCCCCTGGTTCTCTCTCAGG + Intergenic
932357381 2:71077713-71077735 CAGGAAGCAGGTTCTCTCTGGGG - Intronic
933760044 2:85666761-85666783 CCGTCAGCTGGGCCTCTCTGAGG + Intronic
936470610 2:112795736-112795758 CATCCTGCTCGTTCTCTCTTGGG - Intergenic
936890951 2:117369495-117369517 CTGTCAGCTCTTTTTCTCTTTGG + Intergenic
939696978 2:145338688-145338710 CAGACAGGTCCTTCTCTCTCAGG - Intergenic
940297819 2:152146738-152146760 TAGTCACCTCTTTCTCTCTTTGG + Intronic
941838329 2:170051190-170051212 CAGTCAGCTCTTTGTACCTGTGG - Intronic
942415621 2:175756146-175756168 CAGTCAGCCCTCTGTCTCTGTGG - Intergenic
946292545 2:218756123-218756145 CAGGCAGCTCATTTTCTCTTAGG - Intergenic
1172970572 20:38870454-38870476 CAGTCAGGTGGGTCCCTCTGAGG + Intronic
1173946433 20:46954527-46954549 CTGGCAGCTCGCTCTCTTTGAGG + Intronic
1175357789 20:58382660-58382682 CAGTCAGCGGGTTTTCTCTCAGG + Intergenic
1176231048 20:64033105-64033127 CAGCCTGCTGGTTTTCTCTGGGG + Intronic
1178495023 21:33079077-33079099 CAGTCAGCTTGTGGCCTCTGGGG - Intergenic
1184234196 22:43174339-43174361 CAGTCAGCAGGTTCTCGCAGGGG + Exonic
950519863 3:13491689-13491711 CAGTCATGTCCTGCTCTCTGTGG + Intronic
950854664 3:16093845-16093867 GAGTCTGCTCTTTCTCTCTGGGG + Intergenic
951726281 3:25764219-25764241 CAGTCTGCTACTTCTCTCTATGG + Exonic
951914863 3:27789660-27789682 CATTCTGCTGCTTCTCTCTGTGG + Intergenic
954660632 3:52225006-52225028 CAGTCTCCTCGTCCCCTCTGGGG + Intronic
962798286 3:138867646-138867668 CAGTCAGCACATTCTGTCTTTGG - Intergenic
964495119 3:157280304-157280326 GACTCAGCTTGTTCTCTATGTGG + Intronic
969204919 4:5636343-5636365 CAGTCAGCTCTCTGTATCTGTGG + Intronic
969278059 4:6150324-6150346 CAGTCTGCTTGCTTTCTCTGAGG - Intronic
970191717 4:13524226-13524248 CAATCAGCTCTGTCTCTATGCGG + Intergenic
976550663 4:86391591-86391613 CAGTGAGCTCTCTATCTCTGGGG + Intronic
977398874 4:96506803-96506825 CAGTCAGCAGTTTTTCTCTGTGG - Intergenic
980828380 4:138099588-138099610 CAGTCAGCCCTTTGTCTTTGGGG - Intergenic
983790671 4:171793716-171793738 CCGGCAGCCCGTTCTCTCTCTGG + Intergenic
984554691 4:181199675-181199697 CAGTCTGTTCCATCTCTCTGTGG - Intergenic
985922402 5:2987819-2987841 CAATCAGTTCTTTTTCTCTGGGG + Intergenic
986720487 5:10557573-10557595 CACTCAGCTTATTCTCTCTTAGG - Intergenic
987284230 5:16439952-16439974 CAGTCAGCTCTCTGTATCTGTGG - Intergenic
987416817 5:17670784-17670806 CAGGCTGCTCGTTCGCCCTGTGG + Intergenic
991483650 5:67111556-67111578 CAGTCACCCAGTTCTCTCTGAGG - Intronic
993232898 5:85261446-85261468 CAGCCAGCTGGTTCTCTGTCAGG + Intergenic
1000450424 5:161379849-161379871 CAGTCAGCCCTTTCACACTGTGG - Intronic
1000785092 5:165533304-165533326 CAGTCAGCCCTTTCTATCTATGG + Intergenic
1002552145 5:180002511-180002533 GTGTCAGCTCCTTCTCTGTGGGG + Intronic
1003837245 6:10084893-10084915 CTGTCAACTCATCCTCTCTGCGG + Intronic
1007044212 6:38756048-38756070 CAATGAGGTCATTCTCTCTGAGG - Exonic
1007394261 6:41568676-41568698 CATTCTCCTCGTACTCTCTGTGG + Intronic
1012486203 6:99725007-99725029 CAGTCTGCTGGTACTCCCTGTGG - Intergenic
1014647776 6:123995824-123995846 CAGTCAGTTCGTTCTGTTGGAGG - Intronic
1019062103 6:169263820-169263842 CTGTCAGCTGGCTGTCTCTGAGG + Intergenic
1019907970 7:4079074-4079096 CGGCCCGCTCGTTCTCTGTGTGG + Intronic
1019922110 7:4169540-4169562 CAGTGAGCTCGCCGTCTCTGAGG + Intronic
1021550086 7:21861870-21861892 CAGCCTGCTCGATCGCTCTGTGG - Exonic
1021877318 7:25060725-25060747 CTGACAACTCGTTCTCTCTGAGG - Intergenic
1022847520 7:34225960-34225982 CCTTCAGCTCCTGCTCTCTGTGG + Intergenic
1024969748 7:55057754-55057776 CTGACAGCTCATTATCTCTGCGG + Intronic
1026983295 7:74538850-74538872 CAGGCCGCTGTTTCTCTCTGTGG + Intronic
1027134494 7:75614519-75614541 CAGTCAGCTCTCTGTCTCTATGG - Intronic
1032750229 7:134832207-134832229 CAGAAAGCTGTTTCTCTCTGGGG + Intronic
1035120089 7:156559654-156559676 CATTCACCTCCTTCTCTCTTGGG + Intergenic
1035714785 8:1745650-1745672 CAGTCACCTCTTGCTCTCTCGGG + Intergenic
1036618688 8:10408101-10408123 CAGTGAGCCAGTTCTGTCTGTGG - Intronic
1036696583 8:10979117-10979139 CAGTGAGCTCTTTCTCATTGGGG - Intronic
1037712898 8:21369806-21369828 CATTCAGCTCCTGGTCTCTGGGG + Intergenic
1039537420 8:38329856-38329878 CACTGAGCACGTTCTCTCTGAGG + Exonic
1041342969 8:56865549-56865571 GAGTCAGCTGGTTTTCTCTCGGG + Intergenic
1042229855 8:66544501-66544523 CGGTCAGCTCCTTCCCTCTCAGG - Intergenic
1045259362 8:100559122-100559144 AAAGCAGATCGTTCTCTCTGAGG - Intronic
1045882153 8:107053832-107053854 CAGTCTCCTGGGTCTCTCTGAGG - Intergenic
1046520879 8:115324117-115324139 AATTCAGCTCTTTCTCTCTTAGG - Intergenic
1048363296 8:133716087-133716109 CAGTCAGGTGGGTCTCTCTAAGG + Intergenic
1050179589 9:2906003-2906025 TAGTCAGCTTGTTCTCTCTGAGG + Intergenic
1052142567 9:25004655-25004677 TAATCAGCTCTTTCTGTCTGTGG + Intergenic
1052320801 9:27165361-27165383 CATGCAGCTCTTGCTCTCTGTGG - Intronic
1052620138 9:30898256-30898278 CAGGAAGCTGCTTCTCTCTGGGG - Intergenic
1057818969 9:98316662-98316684 AAGTCAGCCCTCTCTCTCTGAGG - Intronic
1061503858 9:131019750-131019772 TAGGCAGCCCCTTCTCTCTGGGG - Intronic
1061922758 9:133791203-133791225 CAGTCACCTCGTCCTGCCTGGGG - Intronic
1188445420 X:30249216-30249238 CAGTCACCACGTCCTCTATGGGG - Intronic
1189046928 X:37603283-37603305 AATTCAGCTCATTCACTCTGAGG - Intronic
1190909246 X:54757061-54757083 CAGTCTGCTCCTTCTCCCTGAGG - Exonic
1200921810 Y:8620000-8620022 AAGTCAGCTCATTCTCTCAGTGG + Intergenic
1202147898 Y:21819681-21819703 AAGGCAGCTAGTTCTCTCAGAGG + Intergenic