ID: 1075912366

View in Genome Browser
Species Human (GRCh38)
Location 10:126135653-126135675
Sequence CAGTGACCCTAAAGGGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075912358_1075912366 1 Left 1075912358 10:126135629-126135651 CCCCGTACATGTCCATGGTAGTA 0: 1
1: 0
2: 0
3: 5
4: 45
Right 1075912366 10:126135653-126135675 CAGTGACCCTAAAGGGGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 203
1075912359_1075912366 0 Left 1075912359 10:126135630-126135652 CCCGTACATGTCCATGGTAGTAA 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1075912366 10:126135653-126135675 CAGTGACCCTAAAGGGGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 203
1075912360_1075912366 -1 Left 1075912360 10:126135631-126135653 CCGTACATGTCCATGGTAGTAAC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1075912366 10:126135653-126135675 CAGTGACCCTAAAGGGGAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075912366 Original CRISPR CAGTGACCCTAAAGGGGAGG AGG Exonic
900134784 1:1111697-1111719 CAGTAACTGAAAAGGGGAGGCGG + Intronic
900739541 1:4322301-4322323 CAGAGAGCCAAAAGGGAAGGTGG + Intergenic
900930378 1:5733432-5733454 CTGTGCCCCTGAAGGGGTGGTGG + Intergenic
902282187 1:15382807-15382829 CAGTGACCGCAAAGGAGAGCTGG + Intronic
902886134 1:19406178-19406200 CAATGACCCAAAAAAGGAGGAGG + Intronic
903446675 1:23426758-23426780 CAGTGGCCGTTGAGGGGAGGAGG + Intergenic
904002733 1:27348040-27348062 CAGTGTCCCTGGAGGGGAGGTGG + Intronic
904068582 1:27774257-27774279 CTCAGACCCTAATGGGGAGGAGG - Intronic
905975615 1:42171638-42171660 CAGTGCCCCAGAAGGGCAGGGGG + Intergenic
906161293 1:43650728-43650750 CAGCGACCCTGCAGGGCAGGGGG + Intronic
907004786 1:50901276-50901298 CAGGGCCCCTTAAGGGGATGGGG + Intronic
907266425 1:53264356-53264378 CAGTGACCCGAAAGAGCAGGAGG - Exonic
907943291 1:59109359-59109381 AAGTGTCCTTAAAGGGGAGAGGG + Intergenic
912206795 1:107517821-107517843 CATTGACCATACAGGGGATGAGG - Intergenic
912392267 1:109311618-109311640 CAGTGACCCTCAATGAGGGGAGG + Exonic
912612830 1:111066206-111066228 CCGTGGCCCTAAATGGGAAGAGG + Intergenic
915085487 1:153385402-153385424 CAGAGACCCTATAGGGGATGAGG + Intergenic
917779345 1:178375426-178375448 AAGTGATACTAAAGGGGAAGAGG + Intronic
920575833 1:207059694-207059716 GAGTGACCCTAGTGGTGAGGAGG - Intronic
920619653 1:207532340-207532362 AAGTGACCCTCAAGGGAATGGGG + Exonic
920621435 1:207550895-207550917 AAGTGACCCTCAAGGGAATGGGG + Exonic
920623062 1:207567984-207568006 AAGTGACCCTCAAGGGAATGGGG + Exonic
920627471 1:207616735-207616757 AAGTGACCCTCAAGGGAATGGGG + Exonic
922412479 1:225389951-225389973 TTGTCATCCTAAAGGGGAGGAGG - Intronic
923037044 1:230291825-230291847 CAGTGACGGTGAGGGGGAGGGGG + Intergenic
1063060461 10:2545771-2545793 CACTGGCCAGAAAGGGGAGGAGG + Intergenic
1064103818 10:12484816-12484838 CAGTGACTCTGGGGGGGAGGGGG + Intronic
1064227575 10:13500892-13500914 CAGTTACGCTGCAGGGGAGGTGG - Intronic
1065705634 10:28469379-28469401 CACTCATCCTAAAGGGGATGAGG - Intergenic
1067168224 10:43882300-43882322 AAGTTACCCTGAAGGGGTGGAGG - Intergenic
1067367515 10:45647516-45647538 AAGTGACCCTAAAAGGGGAGTGG - Intronic
1069683823 10:70304096-70304118 GAGTGATCCTAAAGGTTAGGTGG - Intronic
1072204077 10:93187143-93187165 CAATGAACCTAAAGGTGAGGTGG - Intergenic
1074530849 10:114297710-114297732 CAGTGACCCAAAAGGGTGAGGGG + Intronic
1075406468 10:122199002-122199024 CAATGTCCCTGAAGGGCAGGTGG - Intronic
1075416400 10:122267717-122267739 CAGTCACCCATATGGGGAGGTGG - Intergenic
1075912366 10:126135653-126135675 CAGTGACCCTAAAGGGGAGGAGG + Exonic
1076378685 10:130010454-130010476 CAGTGATTCCAAAAGGGAGGAGG + Intergenic
1077116069 11:885169-885191 CAGTGACCCTTGAGCAGAGGAGG - Intronic
1077430809 11:2515181-2515203 CTGGGACTCCAAAGGGGAGGTGG - Intronic
1077506125 11:2930713-2930735 CAGTGACCCTGAAGGGCAGGTGG - Intergenic
1078100769 11:8329112-8329134 CAGAGAACCTAAGCGGGAGGTGG + Intergenic
1079021798 11:16915118-16915140 CAATGACCCTTAAGGGGATGGGG + Intronic
1079942975 11:26705054-26705076 AAGTGACTCTAAAGGGGAGCTGG - Intronic
1082014984 11:47478640-47478662 CAGTGACCTAAAAGGTTAGGAGG + Intronic
1083654153 11:64220929-64220951 CTGTCACCCTGATGGGGAGGTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1087872592 11:103315624-103315646 AAGTCACCCTAATGGGGAGAGGG - Intronic
1089542588 11:119198846-119198868 CAGTAATTCTAAAAGGGAGGAGG - Intergenic
1090199865 11:124846331-124846353 CAGTGGCACTAATAGGGAGGGGG - Intergenic
1090619213 11:128546772-128546794 TAGTGCCCCTAAAGGGGATAGGG - Intronic
1091235419 11:134019092-134019114 CGGTGGCCCTACAGGGGAAGGGG + Intergenic
1091306437 11:134539194-134539216 AAGTGACACAAAAGTGGAGGTGG - Intergenic
1091844205 12:3642876-3642898 CAGTGATCCTTAATGAGAGGAGG + Intronic
1092428119 12:8390016-8390038 CAGCTAGCCAAAAGGGGAGGGGG - Intergenic
1092882717 12:12900464-12900486 CCTTCTCCCTAAAGGGGAGGAGG + Intronic
1093506254 12:19870463-19870485 CAGAGACCCTAACTGAGAGGCGG - Intergenic
1095183791 12:39178120-39178142 CTGTGCCCCTAAATGGGAAGAGG + Intergenic
1095494159 12:42767512-42767534 CAGTGCCTTTAAAGGGAAGGTGG + Intergenic
1097888824 12:64757479-64757501 TAGTGAACCTAAAGTGTAGGAGG + Intronic
1099825734 12:87775032-87775054 CAGAAACCCTAAAAGGGGGGGGG + Intergenic
1101465281 12:104942557-104942579 CTGTGACTGTATAGGGGAGGAGG - Intronic
1104496957 12:129249928-129249950 CCGTGACCTTAAAGGGCAAGGGG + Intronic
1106213507 13:27673297-27673319 GTGTGATCCTAAAGAGGAGGCGG - Intergenic
1106603747 13:31208968-31208990 CAGGGTCCCTTGAGGGGAGGGGG - Intronic
1108064863 13:46566656-46566678 CAGTGACACTAAAATAGAGGAGG - Intronic
1108585183 13:51864880-51864902 CACTGACCTCAGAGGGGAGGAGG - Intronic
1110713676 13:78677420-78677442 CAGAGACCCTAAGGGGCATGGGG + Intergenic
1111098492 13:83547052-83547074 TAGTAACTCTAAAGGTGAGGTGG - Intergenic
1114523826 14:23355669-23355691 AAAGGAACCTAAAGGGGAGGAGG + Intergenic
1115127679 14:30016097-30016119 CAGTGAGCATAATGGGGAGAGGG - Intronic
1116856719 14:49959140-49959162 CAGTGAGCCGAGATGGGAGGCGG - Intergenic
1117078343 14:52126417-52126439 CCGAGCCCCTAAAGGGTAGGTGG - Intergenic
1119102359 14:71891605-71891627 CACCCACCCTCAAGGGGAGGAGG + Intergenic
1119616637 14:76103144-76103166 ATGTGACCCTAAAGCAGAGGTGG - Intergenic
1120871107 14:89338220-89338242 TTGTGACTGTAAAGGGGAGGAGG + Intronic
1121391798 14:93582256-93582278 CATAGGCCCTGAAGGGGAGGAGG + Exonic
1121641524 14:95487660-95487682 CAGGGAGCTTAAAGGGGAGGCGG - Intergenic
1125919806 15:43518639-43518661 CAGTGAGGCAGAAGGGGAGGGGG - Intronic
1126140277 15:45431848-45431870 CAGTTCCCCTAAAGGGTAGGAGG - Intronic
1129252782 15:74318130-74318152 CAGAGAGACTAAGGGGGAGGGGG + Intronic
1129411873 15:75354774-75354796 CAGTGCCCAAGAAGGGGAGGAGG + Exonic
1129703716 15:77782776-77782798 CAGGGACCCTTGAGGGGAGGTGG - Intronic
1130367447 15:83253209-83253231 AAGGGACCCTAAAGGGTAAGGGG + Intergenic
1130552284 15:84897787-84897809 CAGAGACTCTGAAGGGGAGGAGG - Intronic
1130906977 15:88247601-88247623 CAGTGACCCTACGGGGGTGCCGG + Intronic
1131709473 15:95037546-95037568 CAGTGGCCCTAAATGGGAACAGG + Intergenic
1132840589 16:1976791-1976813 CTGTGACCCAACAGGAGAGGAGG - Intronic
1135058691 16:19252737-19252759 CAGTGACCCTAATGTGTAGCCGG - Intronic
1136277561 16:29187835-29187857 CAGTGCCCCCTAAGGAGAGGAGG - Intergenic
1137701739 16:50502590-50502612 CAGGGAACCAGAAGGGGAGGTGG - Intergenic
1138116056 16:54361624-54361646 CAGTGGCACTGAAGGGGAGGAGG + Intergenic
1141494137 16:84395274-84395296 CAGTGACACTGGAGGGGAGAGGG - Intronic
1143346725 17:6254995-6255017 CAGTGACCACAGAGGGGAGCTGG + Intergenic
1143526512 17:7476166-7476188 CGTTGACCCTCAGGGGGAGGAGG - Intronic
1148829498 17:50421804-50421826 CAGTGATCATGAAGGAGAGGTGG - Intergenic
1149415614 17:56456750-56456772 AAGTGACACTAAAGGGATGGGGG + Intronic
1149665430 17:58361852-58361874 CAAAGACCCTAAATGGGAGAGGG - Intronic
1151341606 17:73474766-73474788 GGGTGACCCTAGAGGGGAGATGG + Intronic
1155890046 18:31256433-31256455 TAGTGACTATGAAGGGGAGGTGG - Intergenic
1156885679 18:42132729-42132751 CAGAGACCCTAAGAGGGTGGAGG - Intergenic
1157161665 18:45319143-45319165 CAGTGGTCCTAAAGAGGAGCTGG - Intronic
1158941946 18:62412641-62412663 CAGAGACCCTCACAGGGAGGAGG - Intergenic
1160332473 18:78007159-78007181 TTGTGACCCTAAAGGTGAAGGGG - Intergenic
1161004773 19:1929791-1929813 CTGTGACCCTGAAGGGGACGTGG - Intergenic
1162033618 19:7927671-7927693 CAGGAACCCCAAAGGCGAGGTGG - Exonic
1162974901 19:14203122-14203144 CAGTGACCCTGAAGGTGCCGTGG - Intronic
1163329500 19:16627745-16627767 CAGCGGCCCTCGAGGGGAGGTGG + Intronic
1163369882 19:16896183-16896205 CCCTGAGCCTGAAGGGGAGGCGG - Exonic
1164188743 19:22896355-22896377 CAGGGACTCCAAAAGGGAGGAGG - Intergenic
1165363489 19:35350743-35350765 CAGTGAGCCGGAAGGGGAGGAGG - Intergenic
1165365632 19:35363200-35363222 CAGTGAGCCAGAAGGGGACGGGG - Intergenic
1165418592 19:35711027-35711049 CGGGGAACCTAAAAGGGAGGAGG - Intronic
1165789519 19:38483183-38483205 CAGAGCCACTGAAGGGGAGGGGG + Intronic
1166638213 19:44470771-44470793 TGGTGAGCCTAAAGGGGATGGGG - Intergenic
1167201658 19:48069507-48069529 CAGAGACACTGAAGAGGAGGTGG - Intronic
1167382467 19:49146493-49146515 CGGTGTCCCTATAGTGGAGGGGG + Intronic
1168313692 19:55474370-55474392 CAGGGACCCAGATGGGGAGGTGG - Intergenic
1168714408 19:58518600-58518622 CAGGCACCAGAAAGGGGAGGGGG + Intronic
925319451 2:2951075-2951097 CAGAGAACCTGAATGGGAGGGGG - Intergenic
925333543 2:3076852-3076874 CAGAGACCCTCAAGGGAAGAAGG + Intergenic
926507145 2:13731261-13731283 CAGTGACTCCAAAAGGGAGAAGG - Intergenic
926917034 2:17901958-17901980 CAGGGACCCAAAATGAGAGGAGG - Intronic
926999235 2:18775054-18775076 CAGTAATCCTAAAAGGGAGAAGG - Intergenic
927062536 2:19437208-19437230 CTGTGATACTAAGGGGGAGGAGG - Intergenic
927255569 2:21037780-21037802 CAGTGAGCCTAAGGGGCAGGAGG + Intronic
931427253 2:62182566-62182588 CAGAGAAGCAAAAGGGGAGGCGG - Intergenic
934910108 2:98244945-98244967 CACTGACCATAAAGGGCAGAAGG - Intronic
937112618 2:119378230-119378252 CAGTTTCCCTAAAGGGGATGGGG + Intergenic
937701548 2:124868130-124868152 CAGGGAACCTAAAGAGGAGCAGG - Intronic
937878753 2:126849585-126849607 CACTGACTCTAAAGGGATGGGGG - Intergenic
938861711 2:135376043-135376065 CAGTGTCCCTATAAGGGAAGAGG + Intronic
939883334 2:147654757-147654779 CAATGATCCCAAAGGGGAGTGGG + Intergenic
942007748 2:171723789-171723811 CAGTGACCCTGCTGAGGAGGCGG - Intronic
945257431 2:207813996-207814018 AAATGACCCTAAAGAGGAGTGGG + Intergenic
948813280 2:240496665-240496687 CAGTGACCCTAAGGTGACGGTGG + Intronic
948888053 2:240893617-240893639 CACTCACCTTAAAGGGGAAGTGG - Intronic
948916319 2:241036446-241036468 CAGGAACCCTGGAGGGGAGGCGG + Intronic
1169301716 20:4447180-4447202 CAGTGACACTAAGAGGGAGGAGG - Intergenic
1171769912 20:29314407-29314429 CAGACACTCCAAAGGGGAGGAGG + Intergenic
1172902795 20:38347087-38347109 CAGAGACCCTGAAGGGCATGAGG + Intronic
1173558821 20:43987350-43987372 CAGTTACCCTAGAGGGGGGTGGG + Intronic
1173575575 20:44111188-44111210 CAGGGACCCCAAAGGGATGGAGG - Intergenic
1173821373 20:46022309-46022331 AGGAGCCCCTAAAGGGGAGGCGG + Intronic
1173883954 20:46440275-46440297 CATTCATCCTAAAGAGGAGGAGG + Intergenic
1175177560 20:57121698-57121720 AAGTGTCCTTAAAGGGGAGGGGG - Intergenic
1175940758 20:62536540-62536562 CTGTGACCCTCCTGGGGAGGCGG + Intergenic
1179389739 21:40976913-40976935 CAGTGACCCTTTAGTGAAGGAGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1182562749 22:31174024-31174046 CAGAGACCTTAAAAGGGAGGGGG + Intronic
1182936705 22:34229587-34229609 CAGTGTCCCTAAGGTGGAGAGGG - Intergenic
1183228041 22:36563588-36563610 CAGGCACCCTAACGGAGAGGAGG + Intergenic
1184841002 22:47052394-47052416 GAGGGACCCTCAAGGTGAGGAGG + Intronic
949244100 3:1905179-1905201 CAGTGACAAAAATGGGGAGGTGG + Intergenic
950693182 3:14677266-14677288 CAGTGCCAGTAAAGGGGTGGAGG + Intronic
953585683 3:44199239-44199261 CAGTGACCCACAAAGGTAGGTGG + Intergenic
954215534 3:49122362-49122384 CTGTGTCCCTATAGAGGAGGGGG - Exonic
954791862 3:53139261-53139283 CACTGGTCCTTAAGGGGAGGAGG + Intergenic
956118414 3:65941611-65941633 CAGTGGTTCTTAAGGGGAGGTGG - Intronic
958061266 3:88484597-88484619 TAATGACACTAAAGGGGATGAGG + Intergenic
959588618 3:108051114-108051136 CATTGTGCCTAAAGGGCAGGTGG - Intronic
961810722 3:129520082-129520104 CACTGCCTCTCAAGGGGAGGGGG - Intronic
963653551 3:148015514-148015536 CAGTGTCCCTGAAGGTGAAGAGG + Intergenic
965032725 3:163393417-163393439 CAGAGACCCTACAGGACAGGGGG + Intergenic
968551454 4:1225763-1225785 ACGTGAACCTAAAGTGGAGGTGG - Intronic
969606788 4:8205887-8205909 CTGAGACCCTGAAGGGGACGAGG + Intronic
976006055 4:80431719-80431741 CAGTGACCCCGAAGGTGAAGAGG - Intronic
978520738 4:109612564-109612586 TAGTGGCCCTTAAGAGGAGGAGG - Intronic
980323557 4:131310321-131310343 CAGAGACCCTAAAAGGGTTGAGG - Intergenic
981133167 4:141181197-141181219 CAGTGCCCCTGAAGGGCAAGTGG + Intronic
984478405 4:180266290-180266312 CAGAGTCCCTAAAGGAGAGGAGG + Intergenic
985662515 5:1164203-1164225 CTGTGACCCTCAAGTGCAGGGGG + Intergenic
986591426 5:9374838-9374860 CAGTGAGCCTGGAGGGCAGGAGG - Intronic
988337008 5:29920487-29920509 CAGAAGCCCTAATGGGGAGGGGG - Intergenic
990408484 5:55516226-55516248 CAGTGAGACTAAAGAGGTGGTGG - Intronic
991299087 5:65111310-65111332 CAGTGAAGCTAAAGGGTAGTGGG - Intergenic
996671582 5:126123672-126123694 CCGTGGCCCTAAATGGGAAGAGG - Intergenic
996845244 5:127891500-127891522 GAGAGACCTTAAATGGGAGGAGG - Intergenic
1001517090 5:172363604-172363626 CAGGGACCCGAGAGAGGAGGAGG + Intronic
1002026848 5:176401530-176401552 CAGTGCCCTTGTAGGGGAGGAGG + Intronic
1003498915 6:6687811-6687833 CAGGGACCCCAAAAGGAAGGAGG - Intergenic
1005919713 6:30389954-30389976 CAGTCACCCAAGAGGGAAGGTGG - Intergenic
1016997127 6:149968528-149968550 CAGTCACCATAAGTGGGAGGAGG + Intronic
1016998434 6:149977392-149977414 CAGTCACCATAAGGGGGAGGAGG + Intergenic
1017001670 6:150001725-150001747 CAGTCACCATAAGGGGGAGGAGG - Intergenic
1017433054 6:154390347-154390369 CAGAGTCCATAAAGGGCAGGAGG - Exonic
1018565949 6:165153241-165153263 CAGGGACCCTAAATAGGATGAGG + Intergenic
1019229415 6:170546303-170546325 CAGTCACCCTTCTGGGGAGGAGG + Intronic
1019843679 7:3475204-3475226 AAGTGACACTAAAGAGCAGGAGG - Intronic
1022240833 7:28511244-28511266 CAGAGACCCAAAGTGGGAGGAGG + Intronic
1024268677 7:47625935-47625957 CAGTGAACCGAGATGGGAGGGGG - Intergenic
1025030106 7:55549917-55549939 CAGTGACCATGATGGGGATGGGG - Intronic
1026939868 7:74281367-74281389 CAGTGACCCTGCAGGGAGGGTGG + Intergenic
1027469490 7:78555312-78555334 CAGGGACCCTAAGAGGGTGGAGG + Intronic
1027734473 7:81915259-81915281 TAGTCACCCTAAACGGGAGGTGG - Intergenic
1030664133 7:112255680-112255702 CAGTGATCCTCAAGAGGAAGGGG - Intronic
1032191578 7:129768951-129768973 GAGTGACCCTCAGGGAGAGGAGG - Intergenic
1032508399 7:132452993-132453015 CAGTGACCCCAATTAGGAGGAGG - Intronic
1032712459 7:134472574-134472596 CAGTGATCCTAAAAGTAAGGTGG - Intergenic
1033231017 7:139597340-139597362 CCTTGACCCTGAAGGCGAGGGGG - Intronic
1034099430 7:148438241-148438263 CTGTGACCCTAAATGGGAACAGG - Intergenic
1034674369 7:152881998-152882020 GAAGTACCCTAAAGGGGAGGAGG - Intergenic
1038311533 8:26449421-26449443 GGGTGACCCGAATGGGGAGGCGG + Intronic
1042429672 8:68690586-68690608 CAGTGACCTTATAGAAGAGGTGG - Intronic
1045959756 8:107953356-107953378 CAATGACTCTAAAGGAGAGTAGG + Intronic
1046755720 8:117971022-117971044 CAGTGCCCCTGAAGGGAATGGGG - Intronic
1047182812 8:122605555-122605577 AGGTGACCCAAAAGTGGAGGAGG + Intergenic
1055070136 9:72157586-72157608 CAGAGACACTAAAGGGTAGATGG - Intronic
1055197127 9:73609775-73609797 CAGAGACCCCAATGGGGATGGGG + Intergenic
1056647615 9:88428334-88428356 CGGGGACTCTAAAGGGAAGGAGG - Intronic
1056943839 9:90977229-90977251 CAGTGACCCTAAGAGCAAGGCGG + Intergenic
1057523944 9:95783525-95783547 CAGTGAGACTTAAGGGGAGGGGG + Intergenic
1060673931 9:125495271-125495293 CAGTGACTCTGAATGGGAGGTGG - Intronic
1061817796 9:133206898-133206920 CAGGGACCCTCCAGGGCAGGAGG - Intronic
1061934044 9:133847434-133847456 CAGCAACCCTAAAGGGGCAGTGG + Intronic
1062418467 9:136466365-136466387 CAGAGACCCTTATGGGGAAGAGG - Exonic
1062541801 9:137044857-137044879 CAGTGCCCCTGGATGGGAGGTGG - Intronic
1062573411 9:137195699-137195721 CAGAGAGCCAAGAGGGGAGGAGG + Intronic
1203779896 EBV:95543-95565 CAGCGACCATGAAGGGGATGAGG + Intergenic
1185839609 X:3376369-3376391 CAGTGATTCCAAAAGGGAGGAGG - Intergenic
1186718301 X:12276639-12276661 CAGTAACTCCAAAAGGGAGGAGG + Intronic
1189665352 X:43349650-43349672 CACTCACCCTGATGGGGAGGTGG + Intergenic
1190736995 X:53262303-53262325 CAGTGCCAATAAAGGGAAGGAGG - Intronic
1192760322 X:74089172-74089194 CAGGGACCCTAAATAGTAGGGGG - Intergenic
1195405986 X:104513912-104513934 CAGTGACCCAAAAGGGAAATAGG - Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1200134295 X:153867422-153867444 CAGTAACCCTAAAGGTGTAGTGG + Exonic
1200214390 X:154361141-154361163 AAGTGAGAGTAAAGGGGAGGAGG - Intronic
1201236206 Y:11914495-11914517 CAGTGATTCCAAAAGGGAGGAGG + Intergenic