ID: 1075918190

View in Genome Browser
Species Human (GRCh38)
Location 10:126187815-126187837
Sequence GGACCTAGTGGAACATAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075918190_1075918195 -4 Left 1075918190 10:126187815-126187837 CCTCCTTATGTTCCACTAGGTCC 0: 1
1: 0
2: 1
3: 3
4: 78
Right 1075918195 10:126187834-126187856 GTCCAGGGTAAATGTGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075918190 Original CRISPR GGACCTAGTGGAACATAAGG AGG (reversed) Intronic
900156358 1:1204793-1204815 GGACCCAGTAGAACAGAGGGTGG + Intronic
908977873 1:69920148-69920170 GGACCTGGTGGGACATGGGGCGG - Intronic
910321602 1:85951658-85951680 GGACATAGTAGATTATAAGGGGG - Intronic
913541919 1:119829531-119829553 GGAGATAGTGGAACAGAAGCAGG + Intergenic
913545256 1:119861407-119861429 GGAGATAGTGGAACAGAAGCAGG - Intergenic
913992616 1:143628582-143628604 GGAGGTAGTGGAACAGAAGCAGG - Intergenic
915428312 1:155845380-155845402 GGACCTGGTGGTGCAGAAGGTGG + Intronic
920999060 1:211024522-211024544 GGACCCAGTGGAATATTGGGAGG + Intronic
923163351 1:231337163-231337185 GGACCTAGTGGAATACGATGCGG - Exonic
923163716 1:231339441-231339463 GGACCTAGTGGAATACGATGCGG - Intronic
923904055 1:238362989-238363011 CAAGGTAGTGGAACATAAGGTGG - Intergenic
1065500337 10:26375251-26375273 GGATGTAATGGAACAAAAGGAGG - Intergenic
1067572500 10:47381692-47381714 GGCCCTAGTGCAACATAACTTGG + Intronic
1069327300 10:67246884-67246906 GAACCTTGAGGAACATAAGCCGG - Intronic
1074302239 10:112242935-112242957 GGACCTAGTGGGATATAAGCCGG - Intergenic
1074819057 10:117165677-117165699 GGCCCTAGGGAAACGTAAGGTGG - Intergenic
1075918190 10:126187815-126187837 GGACCTAGTGGAACATAAGGAGG - Intronic
1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG + Intronic
1085567776 11:77530439-77530461 GGACCTTGTGAAATATATGGGGG - Intronic
1096615040 12:52827465-52827487 GAACCTAATGGACCACAAGGAGG + Intronic
1102330263 12:112022721-112022743 GTCCCTTGTGGAATATAAGGGGG + Exonic
1109814962 13:67569414-67569436 GGACCATGTGGACCACAAGGAGG + Intergenic
1112803286 13:103135564-103135586 GGACCAAGTGGAACTTCAGGAGG - Intergenic
1113788112 13:113013483-113013505 GGACACAGTGGAACACAAAGGGG - Intronic
1114419575 14:22570097-22570119 GGACCTAATTCAATATAAGGTGG + Intronic
1121857359 14:97282337-97282359 GGTCCTAAAGGCACATAAGGAGG + Intergenic
1129251577 15:74312163-74312185 GGAACAAGGGGAACATAAGCTGG - Intronic
1130925985 15:88386297-88386319 AGAACTACTGGAAGATAAGGTGG - Intergenic
1139145574 16:64320655-64320677 GGACTTTCTGGAACATCAGGTGG - Intergenic
1146997044 17:37330261-37330283 GGACCTACTGGAGGAGAAGGAGG - Exonic
1147733368 17:42618152-42618174 GAACCTAGTGGTACAGAAGTAGG - Intergenic
1159074006 18:63659692-63659714 GGAAGAAGTGAAACATAAGGTGG - Intronic
930975183 2:57450010-57450032 GGAGAAAGTGGAACATAAGCTGG - Intergenic
931240040 2:60444071-60444093 GAAACTAGTGGAACATAAGGTGG - Intergenic
940012924 2:149073608-149073630 GCACCGAGTGGAAGAAAAGGGGG - Intronic
940061635 2:149577408-149577430 GGAAGTAGTGGCAGATAAGGTGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
1170908405 20:20538436-20538458 GGCCCTAGTGGAACATACTTTGG - Intronic
1173333803 20:42097281-42097303 GGACCTAGAGGAATATCAGGAGG - Intronic
1174647181 20:52096243-52096265 TGACCTAGGGGAACATGAGCGGG - Intronic
1175066801 20:56295997-56296019 GGCAGTAGTGGAACATTAGGTGG - Intergenic
1176143922 20:63557133-63557155 GGCCCTTGAGGAACAAAAGGTGG - Intergenic
1177738248 21:25119933-25119955 GGACACAGTGGAACAAAAGTTGG - Intergenic
1177849951 21:26333962-26333984 GGATCTTGTTGAAGATAAGGTGG + Intergenic
1180009848 21:45041942-45041964 GGCCCTAGTGGGTCAGAAGGCGG + Intergenic
1183237295 22:36629104-36629126 GGACTTAGGGGAACATTGGGAGG + Intronic
953876187 3:46668101-46668123 GGACCTAGTGGGACTGGAGGAGG + Intergenic
959402778 3:105923094-105923116 CGATCTAGTAGGACATAAGGTGG - Intergenic
959456283 3:106566500-106566522 GGACCTGGTAGAACACCAGGAGG - Intergenic
960298145 3:115968696-115968718 AGACCTAGTGAAACATCAGCTGG - Intronic
967529419 3:190531863-190531885 GGACTTAGGGGAACAGGAGGAGG + Intronic
975747942 4:77492933-77492955 GGACCCATTGAAACATAAGAGGG - Intergenic
980572964 4:134646787-134646809 GTTCCTAGTGGAAAATAAAGTGG + Intergenic
981110285 4:140927038-140927060 GGAACTATTAGAACAAAAGGAGG - Intronic
981318297 4:143363417-143363439 GGACCTAATGAAACATGAGCTGG + Intronic
988212633 5:28225596-28225618 GGGCGTAGTGGAACAAGAGGAGG + Intergenic
990272053 5:54152847-54152869 GGGACTAGAGGTACATAAGGTGG - Intronic
992405125 5:76449642-76449664 GCACCTAGTGGACCATTAGTAGG + Intronic
992996384 5:82338223-82338245 GGACCCATTGGATCAAAAGGAGG + Intronic
996227901 5:121023629-121023651 GGAACTAGGGCAACATAAGTAGG - Intergenic
997005127 5:129807468-129807490 GGAATTAGTGGAACTGAAGGAGG - Intergenic
997627787 5:135342687-135342709 GGACCTGGTGGAACGGAATGGGG - Intronic
1010981217 6:82372012-82372034 GGACTGACTGGAACATTAGGTGG + Intergenic
1014799176 6:125759008-125759030 GGACAGAGTGGAACATCAGTGGG + Intronic
1015461824 6:133500346-133500368 GGTTATAGTGGTACATAAGGAGG - Intronic
1019342565 7:515525-515547 GGACCTTTTGTAACATAGGGGGG - Intronic
1019534267 7:1520368-1520390 GGTCCAACTGGAACAGAAGGTGG + Intergenic
1028446692 7:90932588-90932610 GGACTCTGTGGAACATAAGTTGG + Intronic
1029419545 7:100465847-100465869 GAACCTAGGGAAACCTAAGGAGG + Intronic
1030583708 7:111390660-111390682 GGAGCTAATGGACCATAAGAGGG - Intronic
1031497590 7:122469793-122469815 TGATCTAGTGGAACAGAAGCAGG + Intronic
1032925972 7:136604724-136604746 GGACCCAGTGGGACATAATTGGG + Intergenic
1033905649 7:146199042-146199064 GGAGATAGTGGAAAATAAAGGGG - Intronic
1038253327 8:25926637-25926659 TGACAAAGTGGAACATATGGAGG - Intronic
1046171150 8:110508173-110508195 TGACCAAGTGGAACATGGGGAGG + Intergenic
1051039186 9:12785360-12785382 GGACCTAGTGAGACATCAGCTGG - Intronic
1052462715 9:28786933-28786955 AGACCTATTGCAAAATAAGGAGG - Intergenic
1061446363 9:130640432-130640454 GGCCCTAGTGGACCAGAAGTGGG - Intergenic
1062648586 9:137563901-137563923 GGACCTACTAGAACACAACGTGG + Intronic
1186685417 X:11920170-11920192 GGACCAGGGGGAAAATAAGGGGG + Intergenic
1193958859 X:87899008-87899030 GGACCTAGTATAACTTGAGGAGG - Intergenic
1194672266 X:96748654-96748676 TGATATACTGGAACATAAGGTGG + Intronic
1198440280 X:136656592-136656614 GGACTTAGAGGGACAAAAGGAGG + Intronic