ID: 1075918320

View in Genome Browser
Species Human (GRCh38)
Location 10:126188945-126188967
Sequence GTGAATAGATGGATGATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1341
Summary {0: 1, 1: 3, 2: 53, 3: 287, 4: 997}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075918320 Original CRISPR GTGAATAGATGGATGATGAA TGG (reversed) Intronic
900081513 1:861849-861871 ATAAATAGATGGATGATGGATGG + Intergenic
900081529 1:862063-862085 ATAAATAGATGGATGATGGATGG + Intergenic
900202132 1:1413368-1413390 GTGATTGGAAAGATGATGAATGG - Intergenic
900333407 1:2148520-2148542 ATGACTAGATGGGGGATGAATGG - Intronic
900498152 1:2985943-2985965 GTGGATGGATGGATGATGGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498166 1:2986007-2986029 ATGAATGGATGGAGGATGGATGG - Intergenic
900498713 1:2989207-2989229 GTGGATGGATGGATGATAGATGG - Intergenic
900498754 1:2989403-2989425 GTGGATGGATGGATGATGGATGG - Intergenic
900498783 1:2989539-2989561 ATGAATGGATGGAGGATGGATGG - Intergenic
900509449 1:3051637-3051659 GTGGGTAGATGGGTGATGGATGG - Intergenic
900535903 1:3177257-3177279 GTGAATAGATGCTTGATAGATGG - Intronic
900573359 1:3370946-3370968 ATGAATCGATGGATGGTGAATGG - Intronic
900573396 1:3371123-3371145 ATGAATCAATGGATGGTGAATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900573460 1:3371418-3371440 ATGTATGGATGGATGATGAATGG - Intronic
900869373 1:5291003-5291025 ATTGATAGCTGGATGATGAATGG + Intergenic
900930853 1:5736315-5736337 ATGGATGGATGGATGATGGATGG + Intergenic
900930976 1:5737318-5737340 GTTGACAGATGGATGATGGATGG + Intergenic
900930992 1:5737442-5737464 TTGGATGGATGGATGATGAATGG + Intergenic
900931079 1:5738078-5738100 GCTGATAGATGGATGATGGATGG + Intergenic
900939012 1:5785697-5785719 ATGAACAGATAGATGATGGATGG + Intergenic
900993510 1:6108475-6108497 GAGAATGGAAGGATGATGGAGGG + Intronic
900993563 1:6108700-6108722 AGGAATGGAGGGATGATGAAGGG + Intronic
901001214 1:6149651-6149673 ATGGATAAATGGATGATGGATGG + Intronic
901001223 1:6149714-6149736 ATGGATGGATGGATGATGAATGG + Intronic
901001244 1:6149819-6149841 AAGGATGGATGGATGATGAATGG + Intronic
901001298 1:6150144-6150166 GTGGACAAATGGATGATGGATGG + Intronic
901001316 1:6150259-6150281 ATGGATGGATGGATGATGGATGG + Intronic
901006664 1:6175017-6175039 GATAATGGATGGATGATGGATGG + Intronic
901006727 1:6175322-6175344 ATGAATGGATGGTGGATGAATGG + Intronic
901134403 1:6983786-6983808 GTGGATAGATGGTTGATGGATGG + Intronic
901863625 1:12090024-12090046 GTAGATAGATGGATGGGGAAAGG - Intronic
901863652 1:12090133-12090155 GTAGATAGATGGATGGGGAAAGG - Intronic
901863676 1:12090230-12090252 GTAGATAGATGGATGGGGAAAGG - Intronic
901900649 1:12358918-12358940 GGGAATACTTGGAGGATGAAAGG - Intronic
902202607 1:14845125-14845147 GTGGATGAGTGGATGATGAATGG + Intronic
902397932 1:16142663-16142685 GTGGATGGATGGATGAGGGATGG + Intronic
902398066 1:16143145-16143167 GTGAATGGATGGATGATGGATGG + Intronic
902589776 1:17465521-17465543 GTCAATATATGGGGGATGAATGG + Intergenic
902599039 1:17528620-17528642 ATGAATGGATGGAGGATGGATGG - Intergenic
902688839 1:18096960-18096982 GTAAAGAGATGGATGCTGAGGGG - Intergenic
902721196 1:18305312-18305334 ATGGATGGATGGATGATGGATGG + Intronic
902721211 1:18305398-18305420 GATAATGGATGGATGATGGATGG + Intronic
902721223 1:18305475-18305497 ATGGATGGATGGATGATGGATGG + Intronic
902721230 1:18305514-18305536 ATGGATGGATGGATTATGAATGG + Intronic
902721234 1:18305533-18305555 ATGGATGGATGGATGATGGATGG + Intronic
902722826 1:18315534-18315556 ATGAGTGGATGGATGATGGATGG + Intronic
902722857 1:18315665-18315687 GAGAATGGATAGATGATGGATGG + Intronic
903175174 1:21576240-21576262 ATGGATGGATGGATGATGGATGG + Intronic
903357843 1:22758941-22758963 ATGGATGGATGGATGATGGATGG + Intronic
904487970 1:30840120-30840142 GTGGGTGGATGGATGATGGATGG + Intergenic
904581356 1:31546513-31546535 ATGGATGGATGGATGATGGATGG - Intergenic
905493653 1:38365511-38365533 AAGAATGGATGGATGGTGAAGGG - Intergenic
905771333 1:40639925-40639947 GAGAAGAGATGAATGATGATGGG - Intronic
906700600 1:47854917-47854939 GTGAATAGCTGTGTGATGTAGGG + Intronic
906710590 1:47926969-47926991 GTGTATAGATGTATGCTGCATGG - Intronic
907087361 1:51688016-51688038 GTCAATGGATGGACTATGAATGG + Intronic
907790128 1:57655364-57655386 ATGGATGGATGGATGATGGATGG - Intronic
907838882 1:58137474-58137496 GTAGATAGATGGAGGGTGAATGG - Intronic
908437474 1:64120830-64120852 GTGGATGGATGGATGGAGAATGG + Intronic
908901163 1:68958147-68958169 ATGGATGGATGGATGTTGAATGG + Intergenic
910256470 1:85253123-85253145 CAGAAAAGAAGGATGATGAAGGG + Intronic
911473315 1:98345340-98345362 ATCAATAGATGGATGAGGATAGG - Intergenic
911820187 1:102409155-102409177 GTGAACACATGAATGATAAAAGG + Intergenic
911874868 1:103147988-103148010 GTGAAGAGGTTGAGGATGAAGGG - Intergenic
914351302 1:146842759-146842781 ATGGATGGATGGATGATGGATGG + Intergenic
914351312 1:146842805-146842827 GTGAGCAGGTGGATGATGGATGG + Intergenic
914351337 1:146842890-146842912 GTGGATAGGTGGATGGTGGATGG + Intergenic
914351341 1:146842905-146842927 GTGGATGGGTGGATGATGGATGG + Intergenic
914351383 1:146843064-146843086 ATGGATAGGTGGATGATGGATGG + Intergenic
914351393 1:146843115-146843137 ATGGATAGATAGATGATGGATGG + Intergenic
916254768 1:162775698-162775720 GCTAATAGATGGATGATGTTTGG - Exonic
916431749 1:164736494-164736516 GAGAAAAGAAGGAAGATGAAAGG - Intronic
919280352 1:195482176-195482198 GTGTATAGACTGAAGATGAATGG + Intergenic
919357775 1:196547656-196547678 TATAATGGATGGATGATGAATGG - Intronic
919462680 1:197897175-197897197 ATGAATAGATGAATGAATAATGG - Intergenic
919750988 1:201038165-201038187 ATGGATGGATGGATGATGGATGG + Intergenic
919835355 1:201569497-201569519 GTGAAGAGATGAAGGATGCAAGG - Intergenic
919844103 1:201630098-201630120 CTGAATAAATGAATGATGCATGG + Intronic
920287354 1:204890214-204890236 GTGAATGGATGGATGCAGGAAGG - Intronic
920700605 1:208215620-208215642 ATGGATGGATGGATGATGGATGG + Intronic
921480453 1:215658965-215658987 TTGAATTCATGGATGATAAATGG - Intronic
921816172 1:219566414-219566436 TGGAATGAATGGATGATGAATGG - Intergenic
922565887 1:226601601-226601623 GTGGATAGAAGGAGGAAGAAAGG - Intronic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922745708 1:228042389-228042411 ATGGATGGATGGATGATGGATGG + Intronic
922745792 1:228042911-228042933 GTAGATATATGGATGATGGATGG + Intronic
922745795 1:228042926-228042948 ATGGATGGATGGATGGTGAATGG + Intronic
922790583 1:228308791-228308813 GATAATGGATGGATGATGGATGG - Intronic
922790883 1:228310319-228310341 ATGAATGGATGGATTATGAATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922792952 1:228320482-228320504 GATGGTAGATGGATGATGAATGG - Intronic
923478828 1:234363784-234363806 CTGTATAGATGGATGATGGATGG + Intergenic
924134478 1:240949380-240949402 GTGAATGGATGGTGGATGAGTGG - Intronic
1062878785 10:961945-961967 GTGCACAGAGGGAAGATGAAAGG - Intergenic
1062940159 10:1414930-1414952 GTGGATGGATGGATGGTGGATGG + Intronic
1062940175 10:1415011-1415033 ATGGATAGATGGATGATAGATGG + Intronic
1062940219 10:1415189-1415211 GTGAACAGATGGTGGATGGATGG + Intronic
1062940263 10:1415417-1415439 ATGAATAGATGGTGGATGAATGG + Intronic
1062943694 10:1444250-1444272 GGAAATAGATGGATGGTGAATGG - Intronic
1062943720 10:1444374-1444396 GTAGATAGATGGATGGTGAATGG - Intronic
1062943734 10:1444442-1444464 GTAGATAGATGGATGATCAATGG - Intronic
1062943915 10:1445388-1445410 GGATGTAGATGGATGATGAATGG - Intronic
1063018016 10:2097460-2097482 GAAAATAGATGGATAATCAATGG + Intergenic
1063073295 10:2689016-2689038 ATGAGAAGATGGATGATGAATGG - Intergenic
1063490482 10:6459303-6459325 TAGAATGGATTGATGATGAATGG - Intronic
1063658788 10:8018657-8018679 GTGGATAGAAAGATGATGTATGG - Intergenic
1063957964 10:11283525-11283547 GATAATGGATGGATGATGAATGG + Intronic
1063958242 10:11284773-11284795 GTGGATGGATGGATGGTGGATGG + Intronic
1063992456 10:11580839-11580861 ATGAATGGATGAATGACGAACGG + Intronic
1064640918 10:17415156-17415178 GGGAATAGATTGTTGAGGAAGGG - Intronic
1065576117 10:27120345-27120367 GTTAATACATGTATCATGAAAGG + Intronic
1065860770 10:29870778-29870800 ATGAATGGATGGATGGTAAATGG - Intergenic
1065860773 10:29870793-29870815 GTGAATGGATGATAGATGAATGG - Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1066229334 10:33416914-33416936 ATGGATGGATGGATGATGGATGG + Intergenic
1067051490 10:43024063-43024085 ATAAATGGATGGATGATGGATGG + Intergenic
1067051506 10:43024180-43024202 ATGGACAGATGGATGATGGATGG + Intergenic
1067342420 10:45416692-45416714 GTTGAGGGATGGATGATGAATGG + Intronic
1067342460 10:45416889-45416911 GTGAATGGATGGTGGATGGATGG + Intronic
1067349246 10:45461009-45461031 GGGAAAAGAAGGATTATGAATGG + Intronic
1067709629 10:48637607-48637629 GTGAATGGATGGATGGCAAATGG + Intronic
1068521273 10:58080160-58080182 GTGAAGATATTGATGATGAGAGG - Intergenic
1068740652 10:60465592-60465614 GTGACTAGAGGGATATTGAAAGG + Intronic
1069601629 10:69711865-69711887 ATGGATGGATGGATGATGGATGG - Intergenic
1070219048 10:74421315-74421337 ATAAGTAAATGGATGATGAATGG + Intronic
1070667040 10:78352342-78352364 ATGGATGGATGGATGAAGAATGG + Intergenic
1070781574 10:79140552-79140574 GTAAGTGGATGGATGATGGATGG - Intronic
1070964313 10:80520334-80520356 CTGAATAGTTGGATGAGGAATGG + Exonic
1071131212 10:82395660-82395682 ATGAATGGATGGATGATGGATGG - Intronic
1071131215 10:82395675-82395697 ATGAGTGGATGGATGATGAATGG - Intronic
1071173944 10:82901409-82901431 GTGAGAATATGGATTATGAAGGG + Intronic
1071221640 10:83474024-83474046 ATAAGTAGATGGATGAAGAATGG + Intergenic
1071477145 10:86034794-86034816 ATGAACAGATGTATGATGGATGG + Intronic
1071562940 10:86657357-86657379 ATGCAAAGATGGATGATGACAGG + Intronic
1071736778 10:88309686-88309708 GTGAATGGAAGGTTGAAGAAAGG + Intronic
1072276389 10:93827528-93827550 CTGAATAAGTGGATGAAGAATGG + Intergenic
1072450413 10:95535062-95535084 ATGAATGGATGGATGATGGGTGG + Intronic
1072967871 10:99990044-99990066 GTAAATATTTGCATGATGAATGG + Intronic
1073467165 10:103700941-103700963 ATGGATGGATGGATGATGGATGG - Intronic
1073467190 10:103701055-103701077 ATGGATGGATGGATGATGGATGG - Intronic
1073467232 10:103701265-103701287 ATGAATGGATAGATGATGGATGG - Intronic
1073467235 10:103701288-103701310 ATGAATGGATGGATGATGGATGG - Intronic
1073467239 10:103701311-103701333 ATGAATGGATGGATGATGGATGG - Intronic
1073467254 10:103701387-103701409 GTGGATGGATGGATGATGGATGG - Intronic
1073467257 10:103701402-103701424 GTGGATGGATGGATGGTGGATGG - Intronic
1073467274 10:103701484-103701506 ATGAATGGATGGATGATGGATGG - Intronic
1073467279 10:103701511-103701533 GTGGATGGATGGATGATGGATGG - Intronic
1073467282 10:103701526-103701548 GTGGATGGATGGATGGTGGATGG - Intronic
1073467289 10:103701552-103701574 ATGAATGGATAGATGATGGATGG - Intronic
1073467297 10:103701608-103701630 GTGGATGGATGGATGATGGATGG - Intronic
1073467309 10:103701664-103701686 ATGGATGGATGGATGATGGATGG - Intronic
1073467376 10:103702031-103702053 ATGGATAGATGGATGATGGATGG - Intronic
1074239067 10:111618832-111618854 GTCAATAAATGCATGTTGAATGG - Intergenic
1074734453 10:116414245-116414267 AGGAATTGATGAATGATGAAAGG - Intergenic
1074844879 10:117388966-117388988 GTGAAGGGATGGATTGTGAAAGG - Intergenic
1075191574 10:120314528-120314550 GTGAGCAGAGTGATGATGAAGGG + Intergenic
1075862054 10:125685332-125685354 GGGAATAGATGGAGAATGACTGG - Intergenic
1075902089 10:126051382-126051404 GTATATAAATGGATGATGGAAGG - Intronic
1075918320 10:126188945-126188967 GTGAATAGATGGATGATGAATGG - Intronic
1075918324 10:126188979-126189001 ATGGATGGATGGATGGTGAATGG - Intronic
1076136726 10:128050246-128050268 ATGGATGGATGGATGATGGATGG + Intronic
1076270336 10:129147112-129147134 GTGAATAAGTGGAATATGAAAGG - Intergenic
1076602811 10:131670001-131670023 GTGGATGGATGCATGATGGATGG + Intergenic
1076844940 10:133065433-133065455 ATGGATGGATGGATGATGGATGG + Intergenic
1076844985 10:133065582-133065604 GTGGATGGATGGATGGTGGATGG + Intergenic
1076844999 10:133065635-133065657 GTGGATGGATTGATGATGGATGG + Intergenic
1076845122 10:133066050-133066072 GTGGATAGATGGTGGATGGATGG + Intergenic
1076845186 10:133066247-133066269 GTGGATGGATGGATGGTGGATGG + Intergenic
1076931875 10:133536889-133536911 GTGGATGGATGGAGGATGGATGG + Intronic
1077159495 11:1106246-1106268 GTGGATGGATGGATGGTGGATGG - Intergenic
1077354162 11:2107252-2107274 ATGAATACATGGATAATGACTGG + Intergenic
1077357693 11:2126341-2126363 GTGAGTGGGTGGATGATGAGTGG + Intergenic
1077357820 11:2126891-2126913 GTGAATGGGTGGATGGTGAGTGG + Intergenic
1077480882 11:2814004-2814026 ATGGATGGATGGATGATGGATGG + Intronic
1078579405 11:12526927-12526949 GTAAATAGATGGATGAAGGGAGG + Intronic
1079280693 11:19084377-19084399 ATGGATGGATGGATGATGAATGG - Intergenic
1079478521 11:20857328-20857350 GTGAGTGGATGGGTGGTGAATGG - Intronic
1079711393 11:23687187-23687209 GTGAAGACATGGTTGAAGAAGGG - Intergenic
1079841735 11:25410180-25410202 GTAAATAAGTGGAAGATGAAGGG + Intergenic
1079985821 11:27199702-27199724 GTGAATAGATGGACGAATCAGGG - Intergenic
1080101470 11:28464941-28464963 GTGATTAGAAGGAAGATGAAGGG - Intergenic
1080163287 11:29205102-29205124 GTAGGTAGATAGATGATGAAAGG - Intergenic
1081019012 11:37919829-37919851 TTGCATAGATAGATGAAGAATGG - Intergenic
1081765852 11:45609654-45609676 ATGAATTCATGGATGATGAATGG + Intergenic
1081860056 11:46327956-46327978 ATGAATAAATGAATGATGAGAGG - Intergenic
1083151788 11:60796202-60796224 ATGGATGGATGGATGATGTATGG + Intronic
1083201253 11:61122360-61122382 GTGGGTGGATGGATGATGGATGG + Intronic
1083719121 11:64595428-64595450 ATGGATGGATGGATGATGGATGG + Intronic
1083879852 11:65543013-65543035 GTGGATGGATGGATGGAGAAAGG + Intronic
1084413444 11:69016880-69016902 GTGGATGGATGGATGATGGATGG - Intergenic
1084491756 11:69482524-69482546 ATGAATGGATGGATGATGAGTGG + Intergenic
1084543831 11:69803779-69803801 ATGGATGGATGGATGATGGATGG + Intergenic
1084543848 11:69803892-69803914 ATGGATGGATGGATGATGGATGG + Intergenic
1084543876 11:69804057-69804079 ATGAAAAGATGGAAGATGGATGG + Intergenic
1084543894 11:69804188-69804210 TTGAAAAGATGGAAGATGGATGG + Intergenic
1084543902 11:69804227-69804249 ATGGATAGATGGATGATGGATGG + Intergenic
1084596323 11:70119015-70119037 GTGGGTGGATGGATGATGGAAGG + Intronic
1084596335 11:70119072-70119094 GTGAATTGATGGATGCTGGAGGG + Intronic
1084596394 11:70119313-70119335 GTGGGTGGATGGATGATGGAAGG + Intronic
1084596460 11:70119640-70119662 GTGGATGGGTGGATGATGGAAGG + Intronic
1084596474 11:70119697-70119719 GTGAATAGATGGATGCCGGAGGG + Intronic
1084596493 11:70119799-70119821 GTGAATAGATGGATGCCAGAGGG + Intronic
1084697559 11:70764705-70764727 ATGGATGGATGGATGATGGATGG - Intronic
1084773455 11:71359118-71359140 GTGAATAGAAAGATGATGGATGG - Intergenic
1084781803 11:71414780-71414802 GTGGGTAGATGGATGATGGATGG + Intergenic
1084781846 11:71414986-71415008 ATGGGTAGATGGATGATGGATGG + Intergenic
1084781888 11:71415145-71415167 GTGAATGGATGGATGATGGGTGG + Intergenic
1085254842 11:75166595-75166617 GTGGATAGATGATGGATGAATGG - Intronic
1085406840 11:76268555-76268577 GTGGATGGATGGGTGATGGATGG - Intergenic
1085406851 11:76268593-76268615 GTGGATGGATGGGTGATGGATGG - Intergenic
1085406877 11:76268699-76268721 GTGGATGGATGGATGATGGATGG - Intergenic
1085406884 11:76268726-76268748 GTGGATGGATGGGTGATGGATGG - Intergenic
1085528583 11:77178329-77178351 GTGGATGGATGGATGGTGGATGG - Intronic
1086289150 11:85286249-85286271 GTGAATGGATGGTAGATGATGGG + Intronic
1086401978 11:86468331-86468353 ATGGATGGATGGATGATGGATGG - Intronic
1086401989 11:86468392-86468414 ATGGATGGATGGATGATGAATGG - Intronic
1086445477 11:86866496-86866518 ATGAATGAATAGATGATGAATGG - Intronic
1087136843 11:94729702-94729724 TTCTATAGATGGACGATGAAAGG + Intronic
1087226125 11:95601040-95601062 TTGAATGAATGGATGATGAAAGG + Intergenic
1088114855 11:106302526-106302548 AAGAATAGATGGATGATTTAAGG - Intergenic
1088193129 11:107248186-107248208 GTAAATGGATGCATGGTGAATGG - Intergenic
1089419840 11:118323272-118323294 ATGAAAGGATGGATGATAAATGG + Intergenic
1089580049 11:119476061-119476083 ATAAGTAGATGGATGATGGATGG + Intergenic
1089580055 11:119476096-119476118 ATGAATAGATGGATGGTGGGTGG + Intergenic
1089580074 11:119476197-119476219 ATGAATAGATGGATGAATGATGG + Intergenic
1089682550 11:120127253-120127275 GTGGATGGATGGATGTTGGAGGG + Intronic
1090268014 11:125366403-125366425 ATGAATAGATGAATGATGGGTGG - Intronic
1090377940 11:126304570-126304592 ATACATAAATGGATGATGAATGG - Intronic
1090857086 11:130619654-130619676 ATGGATAGATGGAAGATGCATGG - Intergenic
1090910294 11:131112314-131112336 GTGAATTGATGGATGAAAAAGGG - Intergenic
1090995114 11:131859067-131859089 ATGGATGGATGGATGTTGAAGGG - Intronic
1091036641 11:132239979-132240001 ATGGATGGATGGATGATGGATGG - Intronic
1091117902 11:133031578-133031600 GTGAATGGATGGGTGGTGGATGG + Intronic
1091187348 11:133658425-133658447 GTGGATGGATGGATGATGGGTGG + Intergenic
1091187385 11:133658560-133658582 GTGTATAGATGGATGATGGGTGG + Intergenic
1091654676 12:2337001-2337023 ATGGATGGATGGATGGTGAATGG - Intronic
1091969654 12:4775630-4775652 TTATATAGATAGATGATGAAAGG + Intronic
1092440989 12:8502886-8502908 TTGAATAAATGAATGCTGAATGG + Intergenic
1092570292 12:9714249-9714271 GTGATTAGAAAGATAATGAATGG - Intergenic
1092797400 12:12126255-12126277 GTAAATAGCTGGATGATAGAAGG - Intronic
1094226184 12:28048659-28048681 CTGAATAGATGGCTGAAGTAGGG + Intergenic
1094226191 12:28048755-28048777 CTGAATAGATGGCTGAAGTAGGG + Intergenic
1095156632 12:38864300-38864322 GTAAATAAATGGATGATGATGGG - Intronic
1095525510 12:43120177-43120199 ATGAATAGATGAATGAGTAATGG - Intergenic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1096611228 12:52803316-52803338 ATGAATAGATGGATGATGGATGG + Intergenic
1097121005 12:56732342-56732364 GTGAAGAGATGAAAGATGGAAGG - Intronic
1097532430 12:60821234-60821256 ATGAATGGATGGATGATAGATGG + Intergenic
1097915995 12:65020957-65020979 GTTAATAATTTGATGATGAATGG - Intergenic
1098450604 12:70614008-70614030 GTGAAGAGAGGGAAGATGAAAGG + Intronic
1099507005 12:83490533-83490555 GTCAATAGATGGAGAAAGAATGG + Intergenic
1100700242 12:97139668-97139690 GTGAGTAGCAGGAAGATGAAGGG - Intergenic
1100707281 12:97215086-97215108 GTAAAGAGATGGGTGATGGATGG + Intergenic
1101017832 12:100519995-100520017 GTGAATGGAGGAATGAGGAAGGG + Intronic
1101318689 12:103653513-103653535 GTGTGAAGATGGATGATGCATGG + Intronic
1101790862 12:107926260-107926282 GTGATTTGATGTCTGATGAAAGG + Intergenic
1101801096 12:108022524-108022546 ATGAATGAATGGATGATGGAAGG - Intergenic
1102043155 12:109813743-109813765 GTGGATAGATAGATGATATATGG + Intronic
1102504241 12:113373823-113373845 GTAGATGGATGGATGATGGATGG - Intronic
1102506931 12:113389617-113389639 GTGAGTGGATGGATGATAAATGG - Exonic
1102507108 12:113390567-113390589 GTGGGTAGATGGATGATAAATGG - Exonic
1102507133 12:113390703-113390725 GTGGGTAGATGGATGATAAATGG - Exonic
1102789140 12:115629640-115629662 ATGGATGGATGGATGATGGATGG + Intergenic
1102920821 12:116789933-116789955 GTGGATGGATGGATGGTGGATGG + Intronic
1103012783 12:117470064-117470086 GTGGATGGATGGATGAAGGATGG - Intronic
1103012813 12:117470273-117470295 GTGGATGGATGGATGAAGGATGG - Intronic
1103027249 12:117583505-117583527 GTGGGTGGATGCATGATGAATGG + Intronic
1103403915 12:120661386-120661408 ATGAATAGATGCATGGGGAAGGG - Intronic
1103444826 12:120987993-120988015 GTGGGTAGATGGATGATGGATGG - Intronic
1103444842 12:120988056-120988078 GTGGGTGGATGGATGATGGATGG - Intronic
1103444859 12:120988119-120988141 GTGGGTGGATGGATGATGGATGG - Intronic
1103444876 12:120988182-120988204 GTGGGTAGATGGATGATGGATGG - Intronic
1103444892 12:120988245-120988267 GTGGGTGGATGGATGATGGATGG - Intronic
1103834324 12:123807124-123807146 ATGGATGGATGGATGATGGATGG - Intronic
1103900428 12:124300972-124300994 ATGGATGGATGGAGGATGAATGG + Intronic
1104034620 12:125089749-125089771 ATGGATAGATGGATGACGGATGG - Intronic
1104034672 12:125090051-125090073 ATGGATAGATGGATGAGGGATGG - Intronic
1104567608 12:129899329-129899351 ATGGATGGATGGATGATGGATGG + Intronic
1104763961 12:131314544-131314566 ATGGATAGATGGCTGATGGATGG - Intergenic
1104778403 12:131404626-131404648 ATGGATGGATGGATGATGGATGG - Intergenic
1104778422 12:131404704-131404726 ATGGATGGATGGATGATGGATGG - Intergenic
1104778440 12:131404766-131404788 ATGAATGGATGGATGATAAATGG - Intergenic
1104778449 12:131404805-131404827 GTGGATGGATGGATGATGGATGG - Intergenic
1104778505 12:131405022-131405044 GTGGATGGATGGATGATGGATGG - Intergenic
1104778517 12:131405069-131405091 ATGGATGGATGGATGATGGATGG - Intergenic
1104778520 12:131405084-131405106 GTGGATGGATGGATGATGGATGG - Intergenic
1104778534 12:131405135-131405157 GTGGATGGATGGATGATGGATGG - Intergenic
1104778549 12:131405190-131405212 GTGGGTGGATGGATGATGGATGG - Intergenic
1104778561 12:131405233-131405255 ATGGATGGATGGATGATGGATGG - Intergenic
1104778564 12:131405248-131405270 ATGGATGGATGGATGATGGATGG - Intergenic
1104778580 12:131405306-131405328 GTGGATGGATGGATGATGGATGG - Intergenic
1104778606 12:131405381-131405403 ATGGATGGATGGATGATGGATGG - Intergenic
1104779296 12:131409606-131409628 AGGAATAGATGAATGATGGATGG - Intergenic
1104779309 12:131409677-131409699 GTGGATAGATGGATGATGGATGG - Intergenic
1104779333 12:131409815-131409837 ATGGATGGATGGATGATGGATGG - Intergenic
1104896114 12:132164642-132164664 GTGGATGAATGGATGATGGATGG - Intergenic
1104896302 12:132166640-132166662 GTGGATGGATGGATGATGGGTGG - Intergenic
1104896311 12:132166667-132166689 GTGAATGGATGGATGATGGGTGG - Intergenic
1104896431 12:132167121-132167143 GTGGGTGGATGGATGATGGATGG - Intergenic
1105638824 13:22241620-22241642 TGGAATGGATGGATGATGGATGG - Intergenic
1105638828 13:22241640-22241662 TGGAATGGATGGATGATGGATGG - Intergenic
1105966718 13:25391320-25391342 ATGAATAGATGGGTGAAGAATGG - Intronic
1105969528 13:25415442-25415464 GAGAATAAATGGTTGAGGAAGGG - Intronic
1106047558 13:26158060-26158082 ATGAATAGATGAAACATGAATGG + Intronic
1106586309 13:31059184-31059206 ATGAAAAGATGGAGGATGAATGG + Intergenic
1106900611 13:34351427-34351449 ATGAGTAGAGGGATGATGGATGG + Intergenic
1107791659 13:44008119-44008141 GTGAAAAGGGGGATGAAGAACGG + Intergenic
1108536625 13:51387827-51387849 GTGAATATCTGTTTGATGAATGG + Intronic
1108776940 13:53777711-53777733 GGGAATACATGGTTGATGAAAGG - Intergenic
1111135794 13:84041487-84041509 GAGGATAGATGGATAATGAATGG + Intergenic
1111896231 13:94145165-94145187 ATGGATGGACGGATGATGAATGG + Intronic
1112242808 13:97698772-97698794 GTGAATGGATGGAGGATGGTGGG + Intergenic
1112730306 13:102353275-102353297 GTGAAGACTTGGATGGTGAAGGG - Intronic
1113072884 13:106438689-106438711 ATGGATGGATGGATGATGGATGG + Intergenic
1113224734 13:108147352-108147374 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113224753 13:108147450-108147472 CTGAATAGATGGAAGATGGAGGG - Intergenic
1113224809 13:108147793-108147815 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113224838 13:108147939-108147961 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113224860 13:108148036-108148058 CTGAATAGATGGAGGATGGAGGG - Intergenic
1113901076 13:113798458-113798480 GATAATGGATGGATGATGGATGG + Intronic
1113935062 13:113989558-113989580 GTGGATAGATGGATGAGTGATGG - Intronic
1114056600 14:18973950-18973972 GTGAATAGGTGGGTAATGTAAGG + Intronic
1114105949 14:19427777-19427799 GTGAATAGGTGGGTAATGTAAGG - Intronic
1114497976 14:23147097-23147119 GTGAATGGATCTATGATGGATGG - Intronic
1114497992 14:23147171-23147193 GTGGATGGATGGATGATAGATGG - Intronic
1114633422 14:24173715-24173737 GGGAATAGATGGAGGAGGACAGG - Intronic
1115349176 14:32374783-32374805 ATGAATTGATGGATTATAAAGGG - Intronic
1115533411 14:34347521-34347543 GTTGATAGATGGAAGATGAAGGG - Intronic
1116738309 14:48722753-48722775 GTGAATTTATGACTGATGAAAGG + Intergenic
1117267166 14:54101659-54101681 TTGGATAGATAGATGATGGATGG - Intergenic
1117865683 14:60146763-60146785 GTGAAAACATGGATAATGAATGG + Exonic
1117868633 14:60174992-60175014 ATGAATAGATGGAGGAGAAAAGG - Intergenic
1117900706 14:60529580-60529602 ATGAATGGATGGATGATTATAGG - Intergenic
1118507242 14:66426795-66426817 TTGCATAGATGCAGGATGAAAGG - Intergenic
1118722248 14:68602475-68602497 GTGGGTGGATGGATGATGGATGG + Intronic
1119881284 14:78101763-78101785 GTGGATGGATGGAGGGTGAACGG + Intergenic
1120655700 14:87187429-87187451 GTGAACAAATGGAAGAAGAAAGG + Intergenic
1121550600 14:94796662-94796684 CTGACTACATGGATGATGAATGG + Intergenic
1121604861 14:95233312-95233334 GTGGATGGAGGGATGATGGATGG - Intronic
1121739963 14:96244732-96244754 ATGAATACATGAATAATGAAGGG - Intronic
1121902801 14:97709199-97709221 GGGAATTGATGGATTAAGAACGG + Intergenic
1121944265 14:98104304-98104326 GTGAATGGTTGGGTGATGGATGG - Intergenic
1122600758 14:102920568-102920590 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600787 14:102920703-102920725 GTGGATGGATGGATGGTGGATGG - Intergenic
1122600813 14:102920828-102920850 GTGAATAGGTGGATGGTGGATGG - Intergenic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122625110 14:103081159-103081181 GTGACTGGATGGATGGTGAGTGG + Intergenic
1122794173 14:104197516-104197538 GTGGATGGATGGATAATGAGTGG - Intergenic
1122794190 14:104197664-104197686 ATGAATGGATGAATGATGGAGGG - Intergenic
1122794193 14:104197679-104197701 GATGAAAGATGGATGATGAATGG - Intergenic
1122795466 14:104203935-104203957 ATGGATGGATGGATGATGCATGG - Intergenic
1122795488 14:104204074-104204096 GTGGATGGATGGAGGATGCATGG - Intergenic
1122795565 14:104204472-104204494 ATGGATGGATGGATGATGCATGG - Intergenic
1122795584 14:104204591-104204613 GTGGATGGATGGAGGATGCATGG - Intergenic
1122958313 14:105083068-105083090 GTGGATGGATGGATGATGGAGGG - Intergenic
1122958335 14:105083149-105083171 GTGGATGGATGGATGATGGAGGG - Intergenic
1123058844 14:105585379-105585401 ATGGATGGATGGATGATGGATGG - Intergenic
1123083170 14:105705605-105705627 ATGGATGGATGGATGATGGATGG - Intergenic
1124395757 15:29300137-29300159 GTAAATGGATGGATAATGGATGG + Intronic
1124395799 15:29300320-29300342 ATGGATGGATGGATGATGGATGG + Intronic
1124836522 15:33200644-33200666 GTGAATAGTGGGAGGATAAAAGG + Intergenic
1125971367 15:43914488-43914510 CTGGATGGATGGATGATGGATGG - Intronic
1127071557 15:55291757-55291779 GTGAATGAATGGGTGATGAATGG - Intronic
1127517889 15:59713909-59713931 GAGAAGAGATGGAAGAGGAAAGG - Intergenic
1127764016 15:62166980-62167002 GTGAATAGATGGAGGAAGGATGG - Intergenic
1128233749 15:66053128-66053150 GTGAATGTATGGATAATAAATGG + Intronic
1128496616 15:68201850-68201872 GTGAAGAGATGGTGGAGGAAGGG - Intronic
1128518929 15:68362633-68362655 ATGTATAGATGGATGATGAATGG + Intronic
1128903201 15:71444132-71444154 CTTAATAAATGCATGATGAATGG + Intronic
1129126582 15:73447110-73447132 CTGAGTAGATGGTTGAAGAATGG + Intronic
1130163110 15:81422279-81422301 ATGAAAAGATGGTTGCTGAAGGG - Intergenic
1130278184 15:82494593-82494615 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130353602 15:83111209-83111231 GTGAATGTATGGAGGATGGATGG - Intronic
1130353625 15:83111358-83111380 GTGAATAGATGGATGGATGATGG - Intronic
1130470513 15:84221778-84221800 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130478001 15:84336345-84336367 GTCAATAGATGGAGGCTGGATGG - Intergenic
1130493764 15:84451785-84451807 GTCAATAGATGGAGGCTGGATGG + Intergenic
1130592800 15:85226404-85226426 GTCAATAGATGGAGGCTGGATGG - Intergenic
1132019052 15:98344784-98344806 GTGGATGGATGGAGGATGGATGG + Intergenic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030858 15:98437725-98437747 ATGGATGGATGGATGATGGATGG + Exonic
1132030887 15:98437873-98437895 ATGGATGGATGGATGATGGATGG + Exonic
1132030915 15:98437985-98438007 ATGGATGGATGGATGATGGATGG + Exonic
1132030921 15:98438011-98438033 ATGGATGGATGGATGATGGATGG + Exonic
1132030935 15:98438084-98438106 ATGGATAGATGGATGATGAATGG + Exonic
1132030943 15:98438128-98438150 GTGGATGGATGGATGATGGATGG + Exonic
1132358492 15:101191870-101191892 GTAGATAGATGGATGAAGGAAGG - Intronic
1132653706 16:1032785-1032807 GTGGATGGATGGATGATGGATGG - Intergenic
1132653735 16:1032932-1032954 ATGGATGGATGGATGATGGATGG - Intergenic
1132653748 16:1032990-1033012 GTGGATGGATGGATGGTGGATGG - Intergenic
1132653760 16:1033060-1033082 GTGGATGGATGGATGATGGATGG - Intergenic
1132653850 16:1033487-1033509 ATGGATGGATGGATGATGGATGG - Intergenic
1132653853 16:1033502-1033524 ATGGATGGATGGATGATGGATGG - Intergenic
1132653867 16:1033565-1033587 GTGGATGGATGGATGATGGATGG - Intergenic
1132653907 16:1033750-1033772 GTGGATGGATGGATGGTGGATGG - Intergenic
1133204758 16:4226655-4226677 GTGAATGGAAGGATGATGGATGG + Intronic
1133204834 16:4227060-4227082 ATGGATGGATGGATGATGGATGG + Intronic
1133551081 16:6855226-6855248 GTGAACATATGCATGAGGAAGGG + Intronic
1133614023 16:7459022-7459044 GTGAATGGATGGATGAATGATGG + Intronic
1133836809 16:9374825-9374847 CTGAATAAATGGGTGAAGAAAGG + Intergenic
1133910021 16:10057109-10057131 GTGAATGGATGAATGATGGATGG - Intronic
1133988120 16:10683911-10683933 GTAAATAAATGTATGATAAAAGG + Intronic
1134106028 16:11486562-11486584 GTGGATGAATGGATGATGGATGG + Intronic
1134224475 16:12380601-12380623 GTGGATGGATGGATGGTGGATGG - Intronic
1134224579 16:12380930-12380952 GTGGATGGATGGATGGTGGATGG - Intronic
1134224727 16:12381387-12381409 GTGAGTGGATGGATGATGAGTGG - Intronic
1134224740 16:12381433-12381455 GTGGGTAGATGAATGATGGATGG - Intronic
1134224789 16:12381603-12381625 GTGGGTGGATGGATGATGGATGG - Intronic
1134224836 16:12381743-12381765 GTGCATGGATGGATGATGGGTGG - Intronic
1134224855 16:12381818-12381840 GTGAGTGGATGGATGATGGGTGG - Intronic
1134325491 16:13203871-13203893 GTAGATGGATGGATGATGGATGG - Intronic
1134487451 16:14669831-14669853 GTGAATAGATGGAGGATGGCTGG + Intergenic
1134488469 16:14677907-14677929 ATGAATGGATGGATGATGGATGG + Intronic
1134562189 16:15220190-15220212 GAGAAGAGATGGATCATGAAGGG - Intergenic
1134632261 16:15765307-15765329 GAGGATAGACGGATGATGGATGG + Intronic
1134766868 16:16766932-16766954 ATGAATGGATGGATGACAAATGG - Intergenic
1134819995 16:17239326-17239348 GTGGATGGATGGATGATGGATGG - Intronic
1134820023 16:17239464-17239486 GTGGATGGATGGATGATGGATGG - Intronic
1134859392 16:17547651-17547673 GTGGATAGATGGATGAATGAAGG - Intergenic
1134922726 16:18131816-18131838 GAGAAGAGATGGATCATGAAGGG - Intergenic
1135382419 16:22006083-22006105 CTGAATAGAATGATGATGATTGG - Intergenic
1135400188 16:22161589-22161611 GTGGAAGGATGGATGATGGAAGG + Intergenic
1135630106 16:24029783-24029805 GTGAATGGATGAATGAAGGAAGG + Intronic
1135793212 16:25417535-25417557 GTAGATAGATGGAAGATGAATGG - Intergenic
1135888060 16:26331053-26331075 AAGAATAGATGAATGATAAATGG + Intergenic
1136071387 16:27789635-27789657 ATGGGTGGATGGATGATGAATGG + Exonic
1136071391 16:27789677-27789699 ATGAATGGATAGATGATGGATGG + Exonic
1136071397 16:27789704-27789726 ATGGATGGATGGATGATGGATGG + Exonic
1136071418 16:27789826-27789848 GTGGATGGATGGATGAAGGATGG + Exonic
1136071450 16:27790064-27790086 ATGAATGGATAGATGATGGATGG + Exonic
1136295487 16:29299164-29299186 GTGGATAGATGGATGAACAGTGG + Intergenic
1137346079 16:47661278-47661300 GTGAAGAGATGGATGATAGGAGG - Intronic
1137386085 16:48043911-48043933 GTGAATGGATTGATGGTGAATGG - Intergenic
1137386128 16:48044120-48044142 GTGGATGGATGGATGGTGAATGG - Intergenic
1137386134 16:48044143-48044165 CTGGATGGATGGATGGTGAATGG - Intergenic
1137386141 16:48044177-48044199 ATGGATGGATGGATGATGGATGG - Intergenic
1137386145 16:48044196-48044218 ATGGATGGATGGATGATGAATGG - Intergenic
1137386148 16:48044215-48044237 ATGGATGGATGGATGATGAATGG - Intergenic
1137386164 16:48044312-48044334 ATCAATGGATGGATGATGGATGG - Intergenic
1137397974 16:48130360-48130382 GTGAATAAATGAATGAATAAAGG + Intronic
1137765037 16:50971519-50971541 ATGGATAGATGGGTGATGAACGG - Intergenic
1138495670 16:57407741-57407763 ATGGATGGATGGATGATGGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138547765 16:57729695-57729717 ATGGATGGATGGATGATGGATGG + Intronic
1138547855 16:57730054-57730076 ATGGATGGATGGATGATGGATGG + Intronic
1139069123 16:63358696-63358718 GAGAATAAATGGAATATGAAAGG - Intergenic
1139227412 16:65246582-65246604 ATGAATAGGTAAATGATGAATGG - Intergenic
1139982655 16:70872483-70872505 ATGGATAGGTGGATGATGGATGG - Intronic
1139982697 16:70872645-70872667 GTGGATGGGTGGATGATGGATGG - Intronic
1139982701 16:70872660-70872682 GTGGATAGGTGGATGGTGGATGG - Intronic
1139982726 16:70872745-70872767 GTGAGCAGGTGGATGATGGATGG - Intronic
1139982736 16:70872791-70872813 ATGGATGGATGGATGATGGATGG - Intronic
1140654936 16:77130760-77130782 ATGAAGAGAAGGATGAAGAAGGG + Intergenic
1140678923 16:77364634-77364656 GTGGATGGATGGATGGTGGATGG + Intronic
1140781509 16:78301032-78301054 ATGCATGGATGGATGATGGATGG - Intronic
1141045992 16:80716594-80716616 ATCAATGGATAGATGATGAATGG + Intronic
1141096828 16:81168703-81168725 ATGAATGGGTGGAAGATGAATGG + Intergenic
1141110087 16:81265258-81265280 ATGAATGGATGGATGGTGAGTGG - Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141283391 16:82649304-82649326 ATGCATAGATGGAGGATGGATGG + Intronic
1141283394 16:82649319-82649341 ATGGATGGATGGATGATGGATGG + Intronic
1141391319 16:83667047-83667069 AAGGATGGATGGATGATGAATGG + Intronic
1141391324 16:83667074-83667096 ATGGATAGATGGATGATGGATGG + Intronic
1141396462 16:83709418-83709440 GTGCATGGATGAATGCTGAATGG - Intronic
1141421598 16:83921297-83921319 GTTAATGGAAGGAAGATGAATGG + Exonic
1141473639 16:84256968-84256990 ATGAATAGACAGACGATGAACGG + Intergenic
1141483927 16:84326185-84326207 GTGAATGGATAAATGATGGATGG - Intronic
1141483935 16:84326224-84326246 GTGAATGGATAAATGATGGATGG - Intronic
1141619787 16:85231005-85231027 ATGGACAGATGGATGATGGATGG + Intergenic
1141619848 16:85231339-85231361 ATGGACAGATGGATGATGGATGG + Intergenic
1141641856 16:85346244-85346266 ATGGATGGATGGATGATGGATGG + Intergenic
1141641914 16:85346495-85346517 GTAGATAGATGGGTGATGGATGG + Intergenic
1141748849 16:85944957-85944979 ATGGATGGATGGATGATGAATGG - Intergenic
1141898343 16:86972854-86972876 GTAGATGGATAGATGATGAATGG + Intergenic
1142152860 16:88520443-88520465 GTGGGTAGATGGATGGTGGATGG + Intronic
1142244739 16:88964885-88964907 GTGGATAGATGGTGGATGGATGG - Intronic
1142960525 17:3549688-3549710 ATGAGTGGATGGATGATGGATGG + Intronic
1143152311 17:4815243-4815265 ATGGATGGATGGATGATGAAGGG + Intronic
1143301239 17:5912079-5912101 ATGAATGGATGGAAGATGGATGG - Intronic
1143301245 17:5912114-5912136 ATGAATGGATGGAAGATGGATGG - Intronic
1143532527 17:7513553-7513575 GTGAATAGCTGGGTGATGTCGGG - Exonic
1143698616 17:8639993-8640015 AAGAATGGATGGATGATGGATGG + Intergenic
1144482847 17:15641758-15641780 ATGGATGGATGGATGATGGATGG + Intronic
1144865370 17:18332207-18332229 TTGAAGACATGGAGGATGAAGGG + Intronic
1144915839 17:18723273-18723295 ATGGATGGATGGATGATGGATGG - Intronic
1145262426 17:21362483-21362505 ATGGATGGATGGATGATGGATGG + Intergenic
1145262450 17:21362685-21362707 GTGGACTGATGGATGATGAATGG + Intergenic
1145271657 17:21407986-21408008 ATGGATGGATGGATGATGGATGG - Intronic
1145978730 17:28999073-28999095 TTGAATAGAGGGTTGCTGAATGG + Intronic
1146893914 17:36527460-36527482 GTGAATAGATGAATAAGGACAGG + Intronic
1147169822 17:38611436-38611458 GTGAAGAGATGGAGGGTGAGGGG + Intergenic
1147977470 17:44255983-44256005 ATGGATAGATGAATGATGGATGG - Intronic
1147977476 17:44256039-44256061 ATGGGTAGATGGATAATGAATGG - Intronic
1147977502 17:44256179-44256201 ATGAATAGATGGATAATGGATGG - Intronic
1148532704 17:48410151-48410173 TTAAGTAAATGGATGATGAATGG + Intronic
1150634543 17:66903803-66903825 GTGGATAGATGGATGGTGGAGGG + Intergenic
1150683723 17:67303613-67303635 GTGAAAAGAAGGATGATGAGGGG + Intergenic
1150919543 17:69468739-69468761 CAGAAAAGAGGGATGATGAAGGG - Intronic
1151550041 17:74817352-74817374 GTCCATAGATGGATGATGGTTGG - Intronic
1151973297 17:77470195-77470217 GTGAGTGGACGGATGATGAGTGG - Intronic
1152314140 17:79570441-79570463 GATAATATATGGAGGATGAATGG + Intergenic
1152473754 17:80504252-80504274 GTGGATGGAGGGATGATGGATGG + Intergenic
1152767420 17:82148784-82148806 GTGGATAGATGGTAGATGGATGG + Intronic
1153298050 18:3566608-3566630 TTGAATGGATGGATAATGGAAGG + Intronic
1153660549 18:7322022-7322044 ATGGGTAGATGGATGATGGATGG + Intergenic
1153857012 18:9159737-9159759 ATTAATAAATGGATGGTGAAGGG - Intronic
1153885251 18:9458733-9458755 GTAAATAGAGGGAGGAAGAAAGG + Intergenic
1154307812 18:13243518-13243540 GTGGATGGATGGATGATGGATGG - Intronic
1155297991 18:24402841-24402863 CTGAAGAGATGGCTGTTGAAAGG - Intergenic
1155539317 18:26850724-26850746 ATGGATGGATGGATGATGGAGGG - Intergenic
1156345687 18:36255335-36255357 GTCAAGAGACAGATGATGAAAGG - Intronic
1156471602 18:37380520-37380542 GAGAATGGATGGATGATGAATGG - Intronic
1156471604 18:37380535-37380557 ATGGATAGATGGATGGAGAATGG - Intronic
1156554247 18:38049222-38049244 GGGAATAGTGGGATAATGAAAGG - Intergenic
1157755209 18:50211475-50211497 TTGAATAAATGGGTGAAGAAAGG - Intergenic
1158121975 18:54058501-54058523 AAAAACAGATGGATGATGAAAGG - Intergenic
1158317894 18:56231776-56231798 GTGACTAGATGCCTGATGAATGG + Intergenic
1158523095 18:58188206-58188228 GTGAAGAGGTGTCTGATGAAAGG - Intronic
1158549075 18:58419656-58419678 ATGCATGGATGGATGATGCATGG + Intergenic
1158549077 18:58419671-58419693 ATGCATGGATGGATGATGCATGG + Intergenic
1159336211 18:67070742-67070764 ATGAATAAATGAATGAAGAAGGG - Intergenic
1160177220 18:76605330-76605352 AAGAATAGGTAGATGATGAAGGG - Intergenic
1160226839 18:77018458-77018480 GTGGATGGATGGATGACGAATGG - Intronic
1160472778 18:79153153-79153175 GTAAATAAATGGATAATAAATGG - Intronic
1160502437 18:79408832-79408854 ATGGATGGATGGATGATGGATGG - Intronic
1160502494 18:79409143-79409165 ATGGATAGATGGATGACGGATGG - Intronic
1160502560 18:79409521-79409543 ATGAATGGATGGATGATGGATGG - Intronic
1160526572 18:79542138-79542160 GTGGATGGATGGATGTTGGATGG - Intergenic
1160526684 18:79542682-79542704 ATGAATGCATGGATGATGAATGG - Intergenic
1160681769 19:414933-414955 GTGGATGCATGGATGATGAATGG + Intergenic
1160681845 19:415344-415366 ATGGATGGATGGATGATGGATGG + Intergenic
1160692195 19:465269-465291 ATGGATGGATGGATGATGAGTGG + Intronic
1160767903 19:816562-816584 ATGAATGGCTGGGTGATGAATGG - Intronic
1160767908 19:816597-816619 ATGAATGGGTGGATGATGGATGG - Intronic
1160767912 19:816612-816634 ATGAATGGCTGGATGATGAATGG - Intronic
1160926824 19:1550428-1550450 ATGGATGGATGGATGTTGAATGG - Intergenic
1160960331 19:1718117-1718139 GAGAATGGATGGATGATAAATGG + Intergenic
1161049649 19:2156388-2156410 GTGGATGGATGGATGATGGGTGG - Intronic
1161105279 19:2440752-2440774 ATGGATAGATAGATGATGGATGG - Intronic
1161227675 19:3154648-3154670 GTGGGTGGATGGATGATGGATGG + Intronic
1161287294 19:3475449-3475471 GTGGGTGGATGGATGATGGATGG + Intronic
1161287320 19:3475548-3475570 GTGGATAGATGGATGATGAATGG + Intronic
1161287553 19:3476826-3476848 GTGAATAGATGGGTGATGGATGG + Intronic
1161287583 19:3476939-3476961 GTGGGTGGATGGATGGTGAATGG + Intronic
1161287617 19:3477077-3477099 GTGAATAGATGGGTGATGGATGG + Intronic
1161287717 19:3477456-3477478 GTGAACAGATGGGTGATGAATGG + Intronic
1161287722 19:3477482-3477504 ATGGATGGATGGATGATGGATGG + Intronic
1161449100 19:4334697-4334719 CTGGATGGATGGATGATGAATGG - Intronic
1161449120 19:4334802-4334824 ATGAGTGGATGGATGATGGAGGG - Intronic
1161449152 19:4334947-4334969 GTGGGTGGATGGATGATGGACGG - Intronic
1161449206 19:4335189-4335211 GTGGATGGATGGATGATGGATGG - Intronic
1161449217 19:4335243-4335265 ATGCATGGATGGATGATGGATGG - Intronic
1161498839 19:4602118-4602140 ATGAATGGATGGATTATGGATGG + Intergenic
1161633118 19:5369339-5369361 ATGAATAGATGGATGATGGATGG - Intergenic
1161657497 19:5525094-5525116 GTGAATGGATGGATGATGGATGG - Intergenic
1161679757 19:5673921-5673943 GTGAGTGGATGGATGATGAATGG - Intergenic
1161681462 19:5681760-5681782 GTGGATGGATGGATGATGGACGG - Intronic
1161800842 19:6416106-6416128 GTGCACAGAGGGATGCTGAAAGG + Intronic
1161916093 19:7229287-7229309 GTGGATGGAGGGATGATGGATGG + Intronic
1162085800 19:8248469-8248491 GTGGACAGATGGATGATGAATGG + Intronic
1162085817 19:8248566-8248588 GTGGACAGATGGATGATGGATGG + Intronic
1162085926 19:8249113-8249135 ATGGGTAGATGGATGATGAGTGG + Intronic
1162424743 19:10587660-10587682 ATGAAGAAATGGATGACGAATGG - Intergenic
1162875225 19:13616399-13616421 ATGAATGAATGAATGATGAATGG - Intronic
1163177176 19:15572510-15572532 GTGAATGGATGTCTGGTGAATGG - Intergenic
1163218174 19:15895984-15896006 ATGGATGGATGGATGATGGATGG - Intronic
1163238478 19:16043599-16043621 ATGGAGGGATGGATGATGAATGG + Intergenic
1163382674 19:16979140-16979162 GTGGATGGGTGGATGATGGATGG - Intronic
1163383596 19:16985502-16985524 ATGGATGGATGGATGATAAATGG + Intronic
1163383606 19:16985538-16985560 GTGGATAGATGGGTGGAGAAAGG + Intronic
1163383620 19:16985597-16985619 ATGGATGGATGGATGATGGATGG + Intronic
1163409630 19:17145940-17145962 ATGGATGGATGGATGATGGATGG + Intronic
1163494009 19:17634141-17634163 ATAAATAGGTGGATGATGGAAGG - Intronic
1163495160 19:17642236-17642258 GAGTATAGATGAATGATGGATGG - Intronic
1163495173 19:17642347-17642369 GTGGCTAGATGGATGATGGATGG - Intronic
1163499620 19:17668407-17668429 GAGAATAGTTGGAGGATGACAGG + Intronic
1163609904 19:18295383-18295405 GTGGATGGGTGGATGGTGAATGG - Intergenic
1163934231 19:20427230-20427252 GTGATTAGAAAGATAATGAATGG - Intergenic
1164597769 19:29541426-29541448 GTGAATGGATGGGGGATGAATGG + Intronic
1164597959 19:29542474-29542496 GTGAGTAGAAGGAAGATGAGTGG + Intronic
1164670297 19:30068536-30068558 ATGGATAGATGGATGATGGATGG - Intergenic
1164706522 19:30324134-30324156 ATGGATGGATGGATGATGCATGG - Intronic
1164895588 19:31874471-31874493 ATGGATGGATGGATGATGGATGG - Intergenic
1164920545 19:32085445-32085467 ATGGATGGATGGATGATGAATGG + Intergenic
1165190271 19:34057234-34057256 GTGGATGGACGGATGATGAAAGG + Intergenic
1165190288 19:34057324-34057346 ATGGATGGATGGATGATGGATGG + Intergenic
1165190325 19:34057497-34057519 ATGGATAAATGGATGATGGATGG + Intergenic
1165787072 19:38468041-38468063 ATGGATGGATGGATGATGGATGG - Intronic
1165819943 19:38668385-38668407 AAGAAAAGATGGACGATGAAGGG + Intronic
1166828189 19:45622257-45622279 GTGGATGGATGGGTGATGAATGG - Intronic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1166907990 19:46127653-46127675 GTAGATAGATAGATGATGGATGG + Intergenic
1166962433 19:46506381-46506403 TTGAACAGATGGAGGAAGAAAGG + Intronic
1167161416 19:47769723-47769745 ATGGATGGATGGATGATGGATGG - Intergenic
1167161424 19:47769758-47769780 ATGGATGGATGGATGATGGATGG - Intergenic
1167161431 19:47769789-47769811 GTGGATGGATGGATGATGGATGG - Intergenic
1167168963 19:47818333-47818355 ATGGATGGATGGATGATGGATGG - Intronic
1167277658 19:48548617-48548639 ATGGATGGATAGATGATGAATGG + Intergenic
1167277673 19:48548699-48548721 GTAGATAGATGGATGTTGAATGG + Intergenic
1167633069 19:50637897-50637919 TTGAATGAATGAATGATGAATGG - Exonic
1168326912 19:55543201-55543223 GTGGATGGATGGATGGTGGATGG - Intronic
1168330881 19:55567783-55567805 ATGGATGGATGGATGATGGATGG + Intergenic
1168330891 19:55567834-55567856 ATGGATGGATGGATGATGGATGG + Intergenic
1168330936 19:55568113-55568135 GTGAATGGATGGTGGATGAATGG + Intergenic
1168508272 19:56954604-56954626 GTGGATAGATGGAGGATGGATGG - Intergenic
925119351 2:1405334-1405356 GTGGGTGGATGGATGATGAATGG - Intronic
925697078 2:6591774-6591796 ATAAATGGATAGATGATGAATGG - Intergenic
925697101 2:6592092-6592114 ATAAATGGATGGATGATGGATGG - Intergenic
926300523 2:11598949-11598971 CTGAAAAGATGGATGATGTTTGG + Intronic
927103264 2:19804196-19804218 ATGCATAGATGGATGATTAAAGG + Intergenic
928708495 2:33977999-33978021 CTGAATAAATGGATAAAGAAGGG + Intergenic
929619342 2:43338750-43338772 GTCCATTGATGAATGATGAATGG - Intronic
930003740 2:46879801-46879823 GTGAATGGATGGATGGTGAGTGG + Intergenic
930058515 2:47270286-47270308 CTCAATAAATGTATGATGAATGG + Intergenic
930387735 2:50718847-50718869 GAGAAGAGATGGAGGATGAGAGG - Intronic
930399087 2:50860471-50860493 GTGAAAAGATGAAAGGTGAAAGG + Intronic
931138984 2:59436291-59436313 GTGAATAGATGTTTGAGGAAGGG + Intergenic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931169181 2:59784538-59784560 ATGAATAGATGGATGATGAATGG + Intergenic
931972340 2:67602643-67602665 ATGGATGGATGGATGATGGATGG + Intergenic
932161026 2:69459673-69459695 GTCAATAAGTGCATGATGAATGG - Intronic
932403752 2:71500157-71500179 ATGAATGGATGAATGATGAGTGG + Intronic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933997593 2:87681139-87681161 AGGAATAAATGAATGATGAATGG - Intergenic
934920246 2:98337871-98337893 ATGGATGGATGGATGATGGATGG - Intronic
935176693 2:100655090-100655112 AAGAAGAGATGGATGAGGAAAGG - Intergenic
935264075 2:101380030-101380052 ATGAATAGATGATAGATGAATGG - Intronic
935441793 2:103106495-103106517 GTAAATAGATGGCTGATGATGGG - Intergenic
935720547 2:105975268-105975290 TTGAATAGAATGATTATGAAAGG - Intergenic
935782249 2:106518631-106518653 ATGGATAGATGGATGAGGACAGG - Intergenic
936243979 2:110810632-110810654 ATGGATGGATGGATGATGGATGG - Intronic
936296259 2:111269731-111269753 AGGAATAAATGAATGATGAATGG + Intergenic
936523051 2:113224086-113224108 GTGGAAGAATGGATGATGAAAGG + Intronic
936816889 2:116471062-116471084 GTTAAAAGAAGGATGATGGAAGG + Intergenic
937970743 2:127546885-127546907 GTGGATAGATGGATGGTGGATGG - Intronic
939679296 2:145110468-145110490 ATGAATAAATAGATGATGAATGG + Intergenic
941012730 2:160320081-160320103 GTAGATAGATGGTTGCTGAAAGG - Intronic
941639123 2:167968682-167968704 CTGAATAGATTGATGCAGAAAGG + Intronic
941750662 2:169132087-169132109 ATGAATAGATGGATGATGAATGG + Intronic
943003404 2:182358927-182358949 GGGAATGGAAGGAAGATGAAAGG - Intronic
943014290 2:182492430-182492452 GTGAACTGATGGATGATAAATGG + Intronic
945159532 2:206874981-206875003 ATGAATAGATGGATGAATGATGG - Intergenic
947233679 2:227918164-227918186 ATGGATGGATGGATGATGGATGG - Intronic
947345111 2:229182598-229182620 GGGAACAGATGGCAGATGAATGG - Intronic
947812726 2:233014711-233014733 GTGGATGGGTGGATGATGGATGG - Intronic
947812837 2:233015136-233015158 GTGGATGGATGGATGGTGGATGG - Intronic
947812841 2:233015151-233015173 GTGAAGGGATGGATGGTGGATGG - Intronic
947812912 2:233015413-233015435 GTGGATGGATGGATGGTGGATGG - Intronic
947812932 2:233015496-233015518 GTGGATGGATGGATGGTGGATGG - Intronic
949065748 2:241989561-241989583 GTGGATGGATGGATGGTGGATGG - Intergenic
949065788 2:241989733-241989755 GTGGATGGATGGATGGTGGATGG - Intergenic
949065838 2:241989948-241989970 GTGGATGGATGGATGGTGGATGG - Intergenic
949065845 2:241989974-241989996 GTGGATGGATGGATAATGGATGG - Intergenic
949065853 2:241990007-241990029 ATGGATGGATGGATGATGGATGG - Intergenic
949065862 2:241990050-241990072 GTGGATGGATGGATGATGGATGG - Intergenic
949065948 2:241990392-241990414 GTGGATAGATGGATGGTGGATGG - Intergenic
949066000 2:241990591-241990613 GTGGATGGATGGATGGTGGATGG - Intergenic
1168791644 20:581378-581400 ATGGATAGATGCATGAAGAATGG - Intergenic
1168984491 20:2036503-2036525 GTGGATAGATGCATAAGGAATGG + Intergenic
1168984520 20:2036686-2036708 GTGAATAGATGCATAAGGAATGG + Intergenic
1169008044 20:2225335-2225357 TTGAATAAATGAATGAAGAATGG + Intergenic
1169778432 20:9282185-9282207 GTGAATAACTGAATGAGGAAAGG - Intronic
1169809327 20:9593336-9593358 GTAAAGAGATTGAGGATGAAGGG - Intronic
1170222191 20:13952673-13952695 GGGTATAGATTGAAGATGAATGG - Intronic
1170323573 20:15130241-15130263 GTGGATGGATGAATGGTGAATGG - Intronic
1170348609 20:15415766-15415788 ATGGATATATGGATGATGGATGG - Intronic
1170361181 20:15548103-15548125 GTGGACAGATGGATGGTGGATGG - Intronic
1170379194 20:15737876-15737898 ATGGATGGATGGATGATGAATGG + Intronic
1170586739 20:17740487-17740509 GTGAATAGGAACATGATGAATGG + Intergenic
1170729532 20:18961162-18961184 GTGAATAGGTGGATGCTGAAGGG + Intergenic
1170841047 20:19924604-19924626 ATGAAGAGGTGGATTATGAAGGG - Intronic
1171069793 20:22057570-22057592 ATGAATAAATGGTGGATGAATGG + Intergenic
1171934315 20:31259101-31259123 GTGGTTAGATGAATAATGAATGG + Intronic
1172230790 20:33334240-33334262 ATGGGTAGATGGATGATGGATGG + Intergenic
1172230814 20:33334342-33334364 GTGGGTAGATGGATGGTGGATGG + Intergenic
1172615475 20:36280636-36280658 GTGGGTGGATGGAGGATGAATGG - Intergenic
1172782055 20:37442702-37442724 ATGGATGGATGGATGATGAATGG - Intergenic
1172849031 20:37947358-37947380 ATGGATAGATAGATGATGGATGG + Intergenic
1172853239 20:37981701-37981723 GTTACCAGATGGTTGATGAAGGG + Intergenic
1173280109 20:41619431-41619453 GAAAATAGATGGAAGAAGAAGGG + Intergenic
1173465899 20:43281119-43281141 GTGTATAGATGAATGATTGAGGG - Intergenic
1173871490 20:46344855-46344877 ATGGGTAGATGGATGATGGATGG - Intergenic
1173918084 20:46724741-46724763 GTAGATGGATGGAGGATGAATGG + Intronic
1174078624 20:47955636-47955658 GTGAAGAGATGAATGAAGGAAGG - Intergenic
1174125618 20:48302983-48303005 ATGGATGGATGGATGAAGAATGG - Intergenic
1174125625 20:48303018-48303040 ATGAATGGATGGATGAAGAATGG - Intergenic
1174279725 20:49430467-49430489 GTGGATGGATGGATGATGGATGG - Intronic
1174306805 20:49619219-49619241 TTGGATAGATGGATGATGGATGG + Intergenic
1174405543 20:50300718-50300740 ATGGAGAGATGGATGATGGATGG + Intergenic
1174577324 20:51545732-51545754 AAGAATGGATGGATGATGGATGG + Intronic
1175165269 20:57039103-57039125 GATAATGGATGGATGATGGATGG + Intergenic
1175165283 20:57039180-57039202 ATGGATGGATGGATGATGGATGG + Intergenic
1175165323 20:57039415-57039437 ATGGATGGATGGATGATGGATGG + Intergenic
1175245051 20:57577172-57577194 GTGGATGGATGGATGAATAATGG + Intergenic
1175301912 20:57948917-57948939 GTGGATAGATGGATGAATAGTGG + Intergenic
1175301975 20:57949249-57949271 GTGGATAGATGGATGAATAGTGG + Intergenic
1175486664 20:59351852-59351874 ATGGATAGATGGATGATTAATGG - Intergenic
1175544176 20:59767471-59767493 ATAAATAGATAGATGATGGATGG - Intronic
1175687982 20:61045209-61045231 ATGAATAGACGGAGGATGGATGG - Intergenic
1175688001 20:61045319-61045341 ATGCATGGATGGATGGTGAAAGG - Intergenic
1175754182 20:61518976-61518998 ATGAATGGATGGATGAAGGATGG - Intronic
1175770483 20:61620267-61620289 GTGGGTAGATGGTTGATGGATGG + Intronic
1175770499 20:61620402-61620424 ATAGATAGATGGATGATGGATGG + Intronic
1175770506 20:61620473-61620495 ATAGATAGATGGATGATGGATGG + Intronic
1175772630 20:61633178-61633200 ATGAATGGATGGAGGATGGATGG - Intronic
1175779179 20:61671570-61671592 GTTTGTGGATGGATGATGAACGG + Intronic
1175779196 20:61671649-61671671 GTGAATGGATGGATAATGGATGG + Intronic
1175779308 20:61672188-61672210 GATAATGGATGGATGATGGATGG + Intronic
1175780278 20:61677763-61677785 ATGGTTAGATAGATGATGAATGG + Intronic
1175780302 20:61678032-61678054 GTAGATAGATGGATGATGGATGG + Intronic
1175798469 20:61787091-61787113 ATGGATGGATGGATGATGGATGG - Intronic
1175817232 20:61889589-61889611 GTGGATGGATGGATGATGGGTGG + Intronic
1175817240 20:61889631-61889653 ATGGATAGGTGGATGATGGATGG + Intronic
1175817248 20:61889681-61889703 GTGGATAGTTGGATGATGGATGG + Intronic
1175817282 20:61889859-61889881 ATGGATAGATGGATGGTGGATGG + Intronic
1175817296 20:61889944-61889966 GTGGATGGTTGGATGATGGATGG + Intronic
1175817313 20:61890032-61890054 GTGGATAGTTGGATGATGGATGG + Intronic
1175817344 20:61890199-61890221 ATGGATAGATGGATGTTGGATGG + Intronic
1175817352 20:61890249-61890271 ATGCATAGATGGATAATGGATGG + Intronic
1175817364 20:61890310-61890332 ATGGATAGATGGATGATGGATGG + Intronic
1175817370 20:61890349-61890371 ATGGATAGATGGATAATGGATGG + Intronic
1175817382 20:61890402-61890424 ATGGATGGATGGATGATGGATGG + Intronic
1175817391 20:61890448-61890470 ATGGATAAATGGATGATGGAAGG + Intronic
1175817406 20:61890524-61890546 GTGGATGGATGGATTATGAATGG + Intronic
1175817856 20:61892990-61893012 GTGAGTAGAGGGATGGTGGATGG + Intronic
1175817877 20:61893073-61893095 GTGAGTAGAGGGATGCTGGATGG + Intronic
1175817897 20:61893152-61893174 GTGAATAGAGGGATGGTGGTTGG + Intronic
1175817960 20:61893389-61893411 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818038 20:61893710-61893732 GTGAATAGAGGGATGGTGGATGG + Intronic
1175818052 20:61893761-61893783 GTGAATAGAGGGATGGTGGATGG + Intronic
1176129826 20:63492027-63492049 ATGGATGGATGGATGATGGAGGG + Intronic
1177498697 21:21921910-21921932 TTGAAAAGATGAAAGATGAAAGG + Intergenic
1178280895 21:31281864-31281886 GTGGATAGATGGATGGTAGATGG + Intronic
1178368634 21:32008836-32008858 ATGGATGGATGGATGGTGAATGG + Intronic
1178666273 21:34549797-34549819 ATGGATGGATGGATGATGGATGG - Intronic
1178788738 21:35678392-35678414 ATGGATGGATTGATGATGAATGG + Intronic
1178788791 21:35678714-35678736 ATGGATGGATGGATGATGAATGG + Intronic
1179125936 21:38590644-38590666 ATGAATACATGGATGATGGATGG - Intronic
1179474751 21:41636035-41636057 ATGGATGGATGGATGATGAATGG - Intergenic
1179474764 21:41636106-41636128 ATGAATGGATGGATGATGGATGG - Intergenic
1179549132 21:42132240-42132262 GTGGATAGATGGATGACCAATGG - Intronic
1179549143 21:42132333-42132355 GTGGATGGATGGATGAACAATGG - Intronic
1179549151 21:42132379-42132401 GTGGATGGATGGATGATGGATGG - Intronic
1179623672 21:42634921-42634943 ATGGATAGAAGGATGATGGATGG - Intergenic
1179623675 21:42634940-42634962 ATGAATAGATGGACAATGGATGG - Intergenic
1179623689 21:42635046-42635068 ATGAATAGATGGACAATGGATGG - Intergenic
1179623728 21:42635361-42635383 ATGGATAGAAGGATGATGGATGG - Intergenic
1179623731 21:42635380-42635402 ATGAATAGATGGACAATGGATGG - Intergenic
1179623740 21:42635467-42635489 ATGGATAGAAGGATGATGGATGG - Intergenic
1179623758 21:42635600-42635622 ATGAATAGATGGACAATGGATGG - Intergenic
1179623771 21:42635779-42635801 ATGGAGAGAAGGATGATGAATGG - Intergenic
1179644117 21:42765159-42765181 GTAGATGGATGGAGGATGAATGG + Intronic
1180024906 21:45155579-45155601 GTGAGTGGATGGATGATGGATGG - Intronic
1180475086 22:15696563-15696585 GTGAATAGGTGGGTAATGTAAGG + Intronic
1181482168 22:23207096-23207118 ATGAATGGTTGGAGGATGAATGG - Intronic
1181536729 22:23550156-23550178 ATGGGTAGATGGATGATGGATGG - Intergenic
1181536733 22:23550175-23550197 GAGAATGGATGGAGGATGGATGG - Intergenic
1181537044 22:23551778-23551800 GAGAATGGATGGAGGATGGAAGG - Intergenic
1181908751 22:26220929-26220951 GTGGATGGATGGATGATGAGTGG + Intronic
1182024267 22:27105470-27105492 ATGTATGGATGGATGATGGATGG + Intergenic
1182060685 22:27395001-27395023 GTGAATGGATAGATAATGGATGG + Intergenic
1182072019 22:27470365-27470387 ATGGATGGATGGATGATGGATGG + Intergenic
1182099734 22:27649418-27649440 ATGGATGGATGGATGATGGATGG + Intergenic
1182099741 22:27649441-27649463 GTGGATGGATGGATGGTGGAAGG + Intergenic
1182227992 22:28814828-28814850 ATGAATGAATGGAAGATGAATGG + Intergenic
1182646703 22:31815859-31815881 GTTAAATGATGGATGAAGAAAGG - Intronic
1182798437 22:33009078-33009100 CTAGATAGATAGATGATGAATGG + Intronic
1182862080 22:33568872-33568894 ATGGATGGATGGATGATGGATGG + Intronic
1183100026 22:35578302-35578324 ATGGATGGATGGATGATGGATGG + Intergenic
1183106502 22:35618839-35618861 ATGAATGGAGGGATAATGAATGG - Intronic
1183262307 22:36803571-36803593 ATGGATGGATGGATGAGGAATGG + Intronic
1183262314 22:36803594-36803616 GTGGATGGAGGGATGAGGAATGG + Intronic
1183303920 22:37071918-37071940 ATGGATGGATGGATGATGGATGG + Intronic
1183303933 22:37071978-37072000 ATGGATGGATGGATGATGGATGG + Intronic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303947 22:37072043-37072065 GTGGATGGATGGATGATGGATGG + Intronic
1183303976 22:37072201-37072223 ATGGATGGATGGATGATGGATGG + Intronic
1183303980 22:37072220-37072242 ATGGATGGATGGATGATGGATGG + Intronic
1183303983 22:37072235-37072257 ATGGATGGATGGATGATGGATGG + Intronic
1183303986 22:37072250-37072272 ATGGATGGATGGATGATGGATGG + Intronic
1183303991 22:37072277-37072299 ATGGATGGATGGATGATGGATGG + Intronic
1183303994 22:37072292-37072314 ATGGATGGATGGATGATGGATGG + Intronic
1183304000 22:37072326-37072348 ATGAATGGATGGATGATGGATGG + Intronic
1183304004 22:37072345-37072367 ATGGATGGATGGATGATGGATGG + Intronic
1183304012 22:37072387-37072409 ATGGATCGATGGATGATGGATGG + Intronic
1183304018 22:37072425-37072447 ATGGATTGATGGATGATGGATGG + Intronic
1183304021 22:37072440-37072462 ATGGATGGATGGATGATGGATGG + Intronic
1183304039 22:37072546-37072568 ATGAATGGATGGATGATGGATGG + Intronic
1183304043 22:37072565-37072587 ATGGATGGATGGATGATGGATGG + Intronic
1183304046 22:37072580-37072602 ATGGATGGATGGATGATGGATGG + Intronic
1183304054 22:37072621-37072643 ATGGATGGATGGATGATGGACGG + Intronic
1183304060 22:37072651-37072673 ATGGATGGATGGATGATGGATGG + Intronic
1183304063 22:37072666-37072688 ATGGATGGATGGATGATGGATGG + Intronic
1183304075 22:37072722-37072744 ATGGATGGATGGATGATGGACGG + Intronic
1183304081 22:37072753-37072775 ATGGATAGATGGATGATGGATGG + Intronic
1183304084 22:37072768-37072790 ATGGATGGATGGATGATGGACGG + Intronic
1183304091 22:37072802-37072824 ATGGATGGATGGATGATGGATGG + Intronic
1183304095 22:37072825-37072847 ATGGATAGACGGATGATGGATGG + Intronic
1183304099 22:37072844-37072866 ATGGATGGATGGATGATGGATGG + Intronic
1183304107 22:37072901-37072923 ATGGATAGATGGATGATGTATGG + Intronic
1183304123 22:37072984-37073006 ATGGATAGATGGATGATGGATGG + Intronic
1183304129 22:37073014-37073036 ATGGATGGATGGATGATGGACGG + Intronic
1183304137 22:37073048-37073070 GTGGATGGATGGATGATGGATGG + Intronic
1183304143 22:37073079-37073101 ATGGATAGACGGATGATGGATGG + Intronic
1183304146 22:37073094-37073116 ATGGATGGATGGATGATGGACGG + Intronic
1183425714 22:37738347-37738369 ATGGGTAGATGGATGATGGATGG + Intronic
1183600023 22:38834593-38834615 ATGGATGGATGGATGATGGATGG - Intronic
1184293233 22:43509107-43509129 ATGGATAGATGGAGGACGAATGG - Intergenic
1184293249 22:43509169-43509191 ATGGATGGATGGATGATGGACGG - Intergenic
1184293369 22:43509593-43509615 GTGAATAGAGGGATGATGGATGG - Intergenic
1184410462 22:44323191-44323213 GTGGACAGATGGATGGTGGATGG - Intergenic
1184410543 22:44323556-44323578 GTGGATGGATGGATGGTGGATGG - Intergenic
1184460213 22:44633616-44633638 ATGAGTGGATGGATGATGAATGG + Intergenic
1184460243 22:44633795-44633817 ATGAGTAGATGGATGATGAATGG + Intergenic
1184460776 22:44636705-44636727 GTGGATGGATGGATGATGGGTGG + Intergenic
1184460829 22:44636927-44636949 ATGGATAGATGGATGATGGATGG + Intergenic
1184460851 22:44637034-44637056 ATGGATAGATGGATGATGGATGG + Intergenic
1184460874 22:44637133-44637155 ATGGATAGATGGATGATGGATGG + Intergenic
1184460907 22:44637276-44637298 ATGGATAGGTGGATGATGGATGG + Intergenic
1184653345 22:45929349-45929371 GTGAATAGATGGATGGATAAAGG - Intronic
1184744698 22:46449482-46449504 GTGGATAGATGGATGAATGATGG - Intronic
1184880683 22:47302594-47302616 ATGGATGGATGGATGATGAATGG - Intergenic
1184930764 22:47679629-47679651 ATGGATGGATGGATGATGGATGG - Intergenic
1184930768 22:47679648-47679670 ATGGATGGATGGATGATGGATGG - Intergenic
1185018792 22:48361149-48361171 ATGGATAGATAGATGATGGATGG + Intergenic
1185018830 22:48361524-48361546 ATGGATAGATGGATGATAGATGG + Intergenic
1185018853 22:48361712-48361734 ATGGATAGATGGATGATGGATGG + Intergenic
1185053519 22:48566102-48566124 ATGGATAGATAGATGATGGATGG + Intronic
1185053521 22:48566117-48566139 ATGGATGGATGGATGATGAATGG + Intronic
1185053584 22:48566405-48566427 GTAGGTGGATGGATGATGAATGG + Intronic
1185104436 22:48859229-48859251 ACAGATAGATGGATGATGAAAGG - Intergenic
1185104447 22:48859287-48859309 ATGGATGGATGGATGATGGAGGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185108528 22:48887713-48887735 GTGAATAGATAGATGGTGTGTGG - Intergenic
1185108581 22:48887992-48888014 ATGAATGGATGGTGGATGAATGG - Intergenic
1185146241 22:49138353-49138375 ATGGATGGGTGGATGATGAATGG - Intergenic
1185154565 22:49185410-49185432 ATGGATGGATGGATGGTGAATGG - Intergenic
1185165588 22:49260426-49260448 ATGAATGGATGGATGATGGATGG - Intergenic
1185193338 22:49452610-49452632 GTGAATGGATGGATGATGGTGGG + Intronic
1185193379 22:49452813-49452835 GTGAGTCGATGGATGGTGGAAGG + Intronic
1185193381 22:49452836-49452858 ATGAATAGATGGATCATGAATGG + Intronic
1185196785 22:49476737-49476759 GTGGGTGGATGGATGATGACTGG + Intronic
1185196816 22:49476874-49476896 ATGGATGGATGGATGATGGATGG + Intronic
1185196851 22:49477040-49477062 ATGAATAGATGGATGGTAAATGG + Intronic
1185196856 22:49477062-49477084 GTGGATGGATGGATGATGGATGG + Intronic
1185196874 22:49477140-49477162 GTGGATGGATGGATGGTGAATGG + Intronic
1185196904 22:49477250-49477272 GTGGATGGATGGATGGTGGATGG + Intronic
1185196939 22:49477411-49477433 GTGGATGGATGGATGGTGGATGG + Intronic
1185196943 22:49477426-49477448 GTGGATGGATGGAGGATGGATGG + Intronic
1185196997 22:49477634-49477656 ATGGATGGATGGATGATGGATGG + Intronic
1185197068 22:49477893-49477915 GTGGATGGATGGTGGATGAATGG + Intronic
949404145 3:3697163-3697185 GCGAAGAGATGGATGATGCATGG - Intergenic
950177749 3:10887187-10887209 ATGGATAGATGAATGATAAATGG + Intronic
950177755 3:10887237-10887259 ATGCATGGATGGATGATGAATGG + Intronic
951324936 3:21290275-21290297 GTAAATAGATGGAGGATTATTGG + Intergenic
952206922 3:31189537-31189559 ATGAATGAATGAATGATGAATGG + Intergenic
952307654 3:32160252-32160274 ATGGATGGATGGATGATGGATGG + Intronic
952307671 3:32160312-32160334 GTGAATGGATGGATGATGGGTGG + Intronic
952307705 3:32160431-32160453 GTGAATGGATGGATGATGGGTGG + Intronic
952307735 3:32160537-32160559 GTGAATGGATGGATGATGGGTGG + Intronic
952978548 3:38716875-38716897 ATGGATGAATGGATGATGAATGG + Intronic
955399604 3:58581957-58581979 GTGAATCTATGGATGGTGAGAGG + Intronic
955411094 3:58655985-58656007 GTGAACAGATAGAGGATGGATGG - Intronic
956575046 3:70743390-70743412 GTGAAAAGATGGATGATTAAAGG - Intergenic
956748319 3:72327125-72327147 TTGAATAGATGGAGGATGGGTGG - Intergenic
957070562 3:75564702-75564724 GTGGATAGATGCATGGTGAGTGG + Intergenic
957157424 3:76562968-76562990 GTAAACAGATAGATGAAGAAGGG - Intronic
957410330 3:79831627-79831649 ATCAATGGATGGAGGATGAATGG + Intergenic
958699911 3:97575567-97575589 GGGATTAGATGAATGATAAAGGG + Intronic
960026638 3:113018598-113018620 GTGAAAAGAGGGATGAGGAAAGG + Intronic
961554286 3:127687548-127687570 GAGAATGGATGAATGACGAAAGG - Intergenic
961736410 3:129004511-129004533 GGGGATGGATGGATGATGGATGG - Intronic
961785891 3:129346629-129346651 GTGAGTAGATCGATGGTGACAGG + Intergenic
961999284 3:131278398-131278420 ATGGATAGATAAATGATGAATGG + Intronic
962261642 3:133912959-133912981 GTGGATAGAAGGATGATCGATGG + Intergenic
963008635 3:140749477-140749499 TTGGATGGATGGATGATGGATGG + Intergenic
965418943 3:168432500-168432522 AAGAATAGATGGAAGAGGAAGGG - Intergenic
965682038 3:171261524-171261546 TTGGATGGATGGATGATGGATGG + Intronic
965690020 3:171345927-171345949 ATGAATGAATGAATGATGAATGG + Intronic
965691399 3:171360737-171360759 ATGAATAGATGTATGTGGAAGGG - Intronic
965707909 3:171528233-171528255 TTGAATTGATGTATGTTGAAAGG - Intergenic
965712222 3:171566758-171566780 GGAAAGAAATGGATGATGAATGG + Intergenic
966567466 3:181398866-181398888 ATGAATGGGTGGATGATGGATGG + Intergenic
967019025 3:185506345-185506367 GTGAATGAATGGATAAAGAAAGG - Exonic
968594520 4:1475443-1475465 GTGGATAGATGGGTGGGGAATGG + Intergenic
968924760 4:3541416-3541438 GGAGATAGATGGATGATGAGTGG + Intergenic
968924797 4:3541562-3541584 GGGAATAGATGGATGCTGAATGG + Intergenic
968924809 4:3541607-3541629 GGGGATAGATGGATGATGAATGG + Intergenic
968924884 4:3541903-3541925 GGGGATAGATGGATGATGAATGG + Intergenic
968935815 4:3609860-3609882 ATGCATGGATGGATGATGGATGG - Intergenic
968938871 4:3627714-3627736 GTGTGTAGATGGATAATGAGGGG + Intergenic
969088626 4:4675428-4675450 GTGGATAGATGGATGATGGGTGG - Intergenic
969206531 4:5651409-5651431 ATGAGTAAATGGATGATGGATGG + Intronic
969352488 4:6605836-6605858 GTAGATGGATGGATGATGAATGG - Intronic
969424930 4:7118597-7118619 ATGGATGGATGGATGATGGATGG + Intergenic
969465140 4:7351858-7351880 GTGAATGGATGGGGGATGAATGG - Intronic
969466590 4:7360884-7360906 GTAAAAAGATGCATGAAGAAGGG - Intronic
969510293 4:7613866-7613888 GTGAATGAATGGATGGTGAATGG - Intronic
969510728 4:7616338-7616360 ATGAATAGGTGGATGGTGGATGG - Intronic
969510863 4:7617151-7617173 TTGGATAGATGGATGGTGGATGG - Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969523053 4:7689951-7689973 ATCAATGGATGGATGATGGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969612187 4:8233599-8233621 GTAAATGGATAGATGATGGAAGG - Intronic
969612196 4:8233650-8233672 GTGAATGGGTAGATGATGGAAGG - Intronic
969612205 4:8233689-8233711 ATGGATGGATGGATGATGGATGG - Intronic
969612210 4:8233712-8233734 GTGAATGGATGGATAATGGAAGG - Intronic
969612221 4:8233770-8233792 GTGAATGGATGGATAATGGAAGG - Intronic
969612236 4:8233847-8233869 GTGAATGGATGGATGATGGAAGG - Intronic
969612243 4:8233889-8233911 ATGGATGGATGGATGATGGATGG - Intronic
969612264 4:8234013-8234035 ATGGATGGATGGATGATGGATGG - Intronic
969612271 4:8234055-8234077 ATAAATGGATGGATGATAAAAGG - Intronic
969612279 4:8234117-8234139 ATAAATGGATGGATGATGGAAGG - Intronic
969612287 4:8234160-8234182 ATGGATGGATGGATGATGGAAGG - Intronic
969612290 4:8234175-8234197 ATGAATGGATGGATGATGGATGG - Intronic
969612299 4:8234216-8234238 GTGAATGGATGGATGATGGAAGG - Intronic
969612312 4:8234279-8234301 GTGGATGGATGAATGATGGATGG - Intronic
969624384 4:8294920-8294942 GTGGATGAATGGATGATGGATGG - Intronic
969624392 4:8294955-8294977 GTAAATGGATGGATGATGGATGG - Intronic
969674076 4:8605373-8605395 ATGAATGGGTGGATGATGGATGG - Intronic
969674083 4:8605416-8605438 ATAAATGGATGGATGATGAGTGG - Intronic
969706674 4:8796153-8796175 GTGAATGCATGAATGTTGAATGG + Intergenic
969979456 4:11139614-11139636 GTGGGTAGATAGATGATGGATGG + Intergenic
970064300 4:12074355-12074377 ATGAATAGAGGGATGGTGTAAGG - Intergenic
970213730 4:13737227-13737249 GTGAATGAATGAATGATGAGTGG - Intergenic
971827617 4:31646431-31646453 GAGATTACTTGGATGATGAATGG + Intergenic
973136237 4:46710089-46710111 GCAAATACATGGATGATGAAGGG - Intergenic
975053560 4:69898008-69898030 GAGAAAAGATGGATGCTGCAGGG + Intergenic
975367055 4:73541680-73541702 GTGGAGAGATGGATGATTGATGG - Intergenic
976726002 4:88216284-88216306 GTGATTAGATGGACTATGCATGG + Intronic
976781798 4:88767982-88768004 TTGAATGGATGTCTGATGAAAGG - Exonic
977179117 4:93852196-93852218 GTTAATAGATGGCTGGGGAATGG - Intergenic
977426721 4:96875916-96875938 ATGAATAGATGAATGAACAAAGG + Intergenic
978240873 4:106514860-106514882 ATAGATAGATGGATGATGGATGG + Intergenic
978764530 4:112390584-112390606 TTGGATGGATGGATGATGGATGG + Intronic
979698841 4:123644085-123644107 ATGAATGGATGGGTGATGGATGG - Intergenic
980017704 4:127672094-127672116 TTTAATAGATGGATGTTGCATGG - Intronic
981818234 4:148855770-148855792 TTTAATAGATGGATGATAAATGG - Intergenic
982901186 4:161004264-161004286 GTGTATAGAAGGATCAGGAATGG + Intergenic
983325330 4:166248038-166248060 ATGAAGAGATGGATGTAGAATGG + Intergenic
983430729 4:167647540-167647562 GGCAATAGATTGATGATGGAGGG + Intergenic
983770262 4:171540140-171540162 ATGGATAGATAGATGATGGATGG - Intergenic
983770266 4:171540167-171540189 ATGGATAGATGGATGGTGGAAGG - Intergenic
983779987 4:171656991-171657013 GTGCATTGATGGATGATGAACGG + Intergenic
983779994 4:171658068-171658090 GTGCGTTGATAGATGATGAATGG - Intergenic
983783937 4:171708124-171708146 GTGGATAGATGAAGGATGGATGG - Intergenic
984473230 4:180203778-180203800 GTGCTTAGATGGATGGTGGAGGG + Intergenic
984667717 4:182447170-182447192 GTGAATATATTGATCATTAACGG + Intronic
984756891 4:183332932-183332954 ATGGATGGATGGATGATGGATGG - Intergenic
985476200 5:80634-80656 GAGGAAAGATGGATGAGGAATGG - Intergenic
985656637 5:1135181-1135203 ATGAGTAGATGGAAAATGAAAGG + Intergenic
985709151 5:1418595-1418617 GTGGATGGATGGATGATGGATGG - Intronic
985709182 5:1418735-1418757 ATGGATGGATGGATGATGGATGG - Intronic
985709221 5:1418929-1418951 ATGGATGGATGGATGATGAATGG - Intronic
985709234 5:1419000-1419022 GTGGATTGCTGGATGATGGATGG - Intronic
985709246 5:1419047-1419069 GATAATGGATGGATGATGGATGG - Intronic
985709263 5:1419148-1419170 ATGGATGGATGGATGATGGATGG - Intronic
985712940 5:1440230-1440252 ATGAATAGATAGAAGATGGATGG + Intronic
985829701 5:2219362-2219384 ATGAATGGATGGATTATGAATGG - Intergenic
985829711 5:2219413-2219435 ATGAATGGATGGATGTTGAATGG - Intergenic
985829729 5:2219500-2219522 GTGGATGGGTGGATGGTGAATGG - Intergenic
985901702 5:2800858-2800880 TTGAAGAGATGGATGAGCAATGG + Intergenic
986072879 5:4304430-4304452 ATGAATAGATGGATGATGGATGG - Intergenic
986277827 5:6295639-6295661 TTAAATAAATGGATGGTGAATGG + Intergenic
987068021 5:14308642-14308664 ATGGATGGATGGATGATGAATGG - Intronic
987800435 5:22689242-22689264 GGGAATAGATGGATAAAGCATGG + Intronic
988692629 5:33588150-33588172 GTGAATAGATGGATAATTTGAGG + Intronic
989082797 5:37642293-37642315 ATGAAGAGATGGAAGAAGAAAGG - Intronic
990046205 5:51434780-51434802 GTGAGGAAAAGGATGATGAAGGG - Intergenic
990603114 5:57381234-57381256 ATAGATGGATGGATGATGAACGG + Intergenic
990614948 5:57498286-57498308 GTCAATGGATGGAGGATGGATGG - Intergenic
990885334 5:60585132-60585154 GGGCATAGATGGAGGATAAAGGG + Intergenic
992904195 5:81329474-81329496 GTGAATAGATGGGTGAGGGTTGG + Intergenic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
994922050 5:106058774-106058796 ATGAATAAATGGATAAAGAATGG + Intergenic
996016148 5:118536064-118536086 GAGAATATGTAGATGATGAATGG + Intergenic
996239392 5:121176654-121176676 GTGAAAAGATTCATGATGAGAGG - Intergenic
996876259 5:128243601-128243623 GTGGATAGATGGATGATGGATGG + Intergenic
996876287 5:128243722-128243744 GTAAGTAGATGGATGATGGATGG + Intergenic
997785795 5:136712130-136712152 GTAAACAGATGGAGGATGATAGG + Intergenic
998073108 5:139214164-139214186 GTTATCAGATGGAGGATGAATGG + Intronic
998791793 5:145773728-145773750 GTGAAAAAATGGCTGATAAAGGG - Intronic
999031890 5:148302865-148302887 TTGAATAGATAGATGTTGAATGG + Intergenic
999160319 5:149490707-149490729 GTGAATAGATGAGGGGTGAAGGG + Intergenic
999355052 5:150919779-150919801 GTGAAAAGAAGGATTATAAAGGG - Intergenic
999596560 5:153211488-153211510 ATGCTAAGATGGATGATGAATGG + Intergenic
999710814 5:154316736-154316758 TTGAATACATGAATGATGCAAGG + Intronic
999746742 5:154598186-154598208 ATGAATGGATGGATGATGGCTGG + Intergenic
1000153239 5:158524300-158524322 GTGATTAAATGGAAGATAAAAGG + Intergenic
1000199441 5:158993421-158993443 CTGAATCGATGGATTATCAAGGG + Intronic
1000397261 5:160788834-160788856 GTGGATGGATGGATGGTGGATGG - Intronic
1000989136 5:167894199-167894221 ATGGATGGATAGATGATGAATGG + Intronic
1001192916 5:169647307-169647329 GTGGGTAGATGGATGATAGATGG + Intronic
1001450460 5:171820612-171820634 GTGACTTGATGGATCATGACGGG - Intergenic
1001646256 5:173284368-173284390 ACGAATAGATGGATGGTGGATGG - Intergenic
1001701723 5:173711655-173711677 GTGAATGGATGGAAGAGGGATGG + Intergenic
1001740843 5:174051568-174051590 ATGGATGGATGGATGATGAATGG - Intronic
1001751432 5:174134523-174134545 GTGAATGAATGGATAATGAGTGG - Intronic
1001751444 5:174134584-174134606 GTGAATGGATGGATGATGGATGG - Intronic
1001751463 5:174134687-174134709 ATGGATTGATGGATGATGAATGG - Intronic
1001751473 5:174134741-174134763 ATGGATGGATGGATAATGAATGG - Intronic
1001751495 5:174134893-174134915 ATGGATGGATGGATGATGAATGG - Intronic
1001751498 5:174134912-174134934 ATGGATGGAAGGATGATGAATGG - Intronic
1001768533 5:174274470-174274492 GCAAATTGATAGATGATGAATGG - Intergenic
1001865673 5:175102995-175103017 ATGAATGGATGGATGATGAATGG + Intergenic
1001865678 5:175103026-175103048 ATGGATAGATGGATGATGGATGG + Intergenic
1002067623 5:176660065-176660087 ATGAATGGATGGATGAAGAGTGG - Intergenic
1002298606 5:178245336-178245358 GATAATAGATGAATGATGGATGG - Intronic
1002303299 5:178269543-178269565 ATGGATGGATGGATGATGGATGG - Intronic
1003972588 6:11313354-11313376 CTGAGTAGATGGATGGTGGATGG + Intronic
1005115008 6:22326470-22326492 GAGAAGAGAGGGATGAAGAAAGG + Intergenic
1006370225 6:33639734-33639756 ATGAATAGATGGATGATTGGGGG + Intronic
1007352067 6:41281181-41281203 ATGGACAGATGGATGATGAATGG + Intronic
1008422134 6:51313636-51313658 ATGAATGGATGGATGATGGATGG - Intergenic
1008554697 6:52663598-52663620 CTGAAAAGAGGGATGAGGAAGGG + Intergenic
1009472833 6:64049306-64049328 GTGAAGAGATGGATGAATAGAGG - Intronic
1010979466 6:82354640-82354662 GTGAATAGAGGGATTACAAAAGG + Intergenic
1013657800 6:112263663-112263685 TTGAATGAATGGATGGTGAATGG - Intergenic
1014258259 6:119186000-119186022 GGGAAATGATGGATGAGGAAAGG + Intronic
1015172286 6:130266832-130266854 GTGATTGGAAAGATGATGAATGG + Intronic
1016081283 6:139860698-139860720 ATGTATAGTTGGATGATGATAGG + Intergenic
1016457689 6:144248148-144248170 GTGAATAGATTGATGATTTCAGG - Intergenic
1017405822 6:154117066-154117088 GTCAATAGATGGAGGTTGAAAGG - Intronic
1017966234 6:159269433-159269455 GTGAATAGGTAGATAATGGATGG - Intronic
1018753950 6:166831889-166831911 ATGGATAGATAGATGATGGATGG + Intronic
1018871926 6:167790256-167790278 GTGGGGAGATGGATGATGAGGGG - Intronic
1019055265 6:169218871-169218893 GTGGATGGATGGATGATGAGTGG + Intronic
1019103322 6:169649708-169649730 GTGAATGGATGGGTGATGGTTGG - Intronic
1019326863 7:442769-442791 ATGAATGGATGGTGGATGAATGG + Intergenic
1019326893 7:442920-442942 GTGGATGGATGGTGGATGAACGG + Intergenic
1019326906 7:442988-443010 GTGGATGAATGGAGGATGAATGG + Intergenic
1019326912 7:443018-443040 ATGAATGGATGGAGGATGAATGG + Intergenic
1019326951 7:443190-443212 ATGGATGGATGGAGGATGAATGG + Intergenic
1019326980 7:443339-443361 ATGGATTGATGGAGGATGAATGG + Intergenic
1019327000 7:443437-443459 ATGGATGGATGGATGGTGAATGG + Intergenic
1019327048 7:443633-443655 GTGGATGGATGGATGGTGGATGG + Intergenic
1019327066 7:443727-443749 GTGAATAGATGGATGGTGGATGG + Intergenic
1019345529 7:528229-528251 ATGAATAGATAGATGATTGATGG + Intergenic
1019345559 7:528443-528465 ATGGATGGATAGATGATGAATGG + Intergenic
1019345576 7:528580-528602 ATGAATAGACAGATGATGGATGG + Intergenic
1019345607 7:528802-528824 ATGAATAGACAGATGATGGATGG + Intergenic
1019369877 7:656322-656344 GTGAATGAATGGATGATGCATGG + Intronic
1019479978 7:1261889-1261911 ATAGATAGATGGATGATGGATGG - Intergenic
1019567305 7:1690690-1690712 AAGGATATATGGATGATGAATGG + Intronic
1019567344 7:1690867-1690889 AAGGATATATGGATGATGAATGG + Intronic
1019914669 7:4125073-4125095 ATGGATGGATGGATGATGGATGG + Intronic
1019914699 7:4125219-4125241 ATGGATAGATGGATGATGGATGG + Intronic
1019932128 7:4230568-4230590 ATGAATGGATGGATAATGAATGG + Intronic
1020471197 7:8537168-8537190 ATGAACGGATGGATGATGACAGG + Intronic
1020980805 7:15065877-15065899 GAGAATAGAAGAATGATGTAAGG - Intergenic
1021088418 7:16451689-16451711 GTGAGAAGATTGATGTTGAAAGG + Intergenic
1021880231 7:25088190-25088212 GTGACTATACAGATGATGAAAGG - Intergenic
1022477236 7:30719594-30719616 ATGGATGGATGGATGATGGATGG - Intronic
1023116446 7:36867196-36867218 ATGGATAGATGGATGATGGATGG - Intronic
1023265831 7:38404277-38404299 TTGGGTAGCTGGATGATGAATGG - Intronic
1023314403 7:38920478-38920500 GTGAAAAGAAGGATGGGGAAAGG + Intronic
1023447918 7:40251218-40251240 GTGAAGAGAGGGAAGATGGAAGG - Intronic
1024960976 7:54975963-54975985 ATGAATAGATGGAAGACTAATGG + Intergenic
1025116045 7:56259183-56259205 ATGGATAGATGGATGATGAATGG + Intergenic
1025120126 7:56294746-56294768 GTGGATGGATGGATGGTGAATGG + Intergenic
1025606872 7:63045768-63045790 GTGGATGGATAGATGATGGATGG - Intergenic
1026073189 7:67141480-67141502 GGGAATAAATGGAGTATGAAAGG - Intronic
1026275189 7:68870221-68870243 ATGGATAGATGGATGATGGATGG + Intergenic
1026275192 7:68870244-68870266 ATGAATGGATGGATGATGAATGG + Intergenic
1026275209 7:68870341-68870363 ATGGATGGATGGATGATGGATGG + Intergenic
1026275213 7:68870372-68870394 ATGAATGGATGGATGATGGATGG + Intergenic
1026320488 7:69263736-69263758 TTAGATGGATGGATGATGAAAGG + Intergenic
1026320532 7:69263994-69264016 ATGGATAGATGAATGATGAATGG + Intergenic
1026703698 7:72670742-72670764 GGGAATAAATGGAGTATGAAAGG + Intronic
1026828558 7:73598055-73598077 GTGGATGGATGGATGATGAATGG - Intronic
1026828585 7:73598220-73598242 GTGAATGGATGGAAGACGGATGG - Intronic
1026890708 7:73980233-73980255 CAGAAAAGATGGATGATGAGTGG + Intergenic
1027236233 7:76299596-76299618 GTGTTTAGATGGATGAGGTAGGG + Intergenic
1027382956 7:77631094-77631116 GTGAAGAGATGGCTGTTGGAAGG - Intronic
1028299048 7:89173725-89173747 ATAAATGGATGGATGATAAATGG - Intronic
1028427651 7:90707964-90707986 ATGAATAGATGAAAGATTAAAGG + Intronic
1029604860 7:101592451-101592473 ATGGATGGATGGATGATGGATGG - Intergenic
1029940376 7:104474355-104474377 GTGAATAAAAGGATTAAGAAAGG + Intronic
1030565744 7:111152919-111152941 ATATATAGATGAATGATGAATGG + Intronic
1030627005 7:111855234-111855256 GCTAATAGATGGGTGGTGAAAGG + Intronic
1030926508 7:115462086-115462108 GTTAATAGATGGGAGAGGAATGG - Intergenic
1031547256 7:123066262-123066284 GTCAATAAAAGGATGAAGAAGGG - Intergenic
1031888487 7:127265853-127265875 ATGCATGGATGGATGATGGAAGG + Intergenic
1033379440 7:140799591-140799613 GGGAATAGAAGCATGGTGAAAGG - Intronic
1033683408 7:143618721-143618743 GGGAAAAGAGGGATGAGGAAGGG + Intergenic
1033701205 7:143838917-143838939 GGGAAAAGAGGGATGAGGAAGGG - Intergenic
1034743258 7:153497785-153497807 GTGAATAGTGGGTAGATGAAAGG + Intergenic
1034843623 7:154422678-154422700 GTGGATGGATGGATGGTGAGTGG + Intronic
1034883625 7:154780937-154780959 GTGGATAGATGGATAATGAATGG + Intronic
1034883631 7:154780968-154780990 ATGAATAGATGGATGGTTGATGG + Intronic
1034883636 7:154780995-154781017 GTGAATGGATGGATGATGGGTGG + Intronic
1035278934 7:157765371-157765393 GTGGATAGATGGAAGAAGAGTGG - Intronic
1035278944 7:157765424-157765446 GTGGACAGATGGAGGAAGAATGG - Intronic
1035278963 7:157765501-157765523 GTGAATGGATGGAGGAAGGATGG - Intronic
1035279029 7:157765784-157765806 GTGAATGGATGGAGGAAGGATGG - Intronic
1035279037 7:157765822-157765844 GTGGATGGATGGAGGAAGAATGG - Intronic
1035279058 7:157765919-157765941 GTGGATGGATGGAGGAAGAATGG - Intronic
1035279103 7:157766112-157766134 ATAAGTAGATGGATGATGGATGG - Intronic
1035279154 7:157766343-157766365 ATGGGTAGATGGATGATGGATGG - Intronic
1035452611 7:158988004-158988026 ATGAATTGATGGATGATGCATGG - Intergenic
1035452727 7:158988738-158988760 ATGAATGAATGCATGATGAATGG - Intergenic
1035452741 7:158988829-158988851 GTAAATGCATGGATGATGAATGG - Intergenic
1035523738 8:295484-295506 ATAAATAGATGGATGATGGATGG - Intergenic
1036778059 8:11627214-11627236 GTGGATTGATAGATGATGGATGG + Intergenic
1037266827 8:17072559-17072581 GTTAAAAGATGTATGATGGATGG + Intronic
1037669734 8:21004055-21004077 ATGGATAGATGGAGGATGGATGG + Intergenic
1038325129 8:26567231-26567253 ATGGATAGATGGATGATGGATGG - Intronic
1039040211 8:33400501-33400523 GTGGATAGACGGATGAAGGAAGG + Intronic
1039117112 8:34103470-34103492 CTTAATAGATGGATGATCAGAGG - Intergenic
1040584391 8:48726252-48726274 ATGGATAGATAGATGATGGATGG - Intronic
1040803036 8:51364625-51364647 TTTGATAGATGGAAGATGAAGGG + Intronic
1040956717 8:52987538-52987560 GGGAAAGGAGGGATGATGAAAGG - Intergenic
1041835869 8:62214516-62214538 ATTAAAAGATGGATGATGAGAGG + Intergenic
1042964270 8:74334298-74334320 ATGAATAAATGGTGGATGAATGG - Intronic
1042964295 8:74334439-74334461 ATGGATGGATGGATGATGTATGG - Intronic
1042964331 8:74334595-74334617 ATGAATAGATGGTAGATGCATGG - Intronic
1044220837 8:89667752-89667774 AAGAATAGATGGAAGATGAAGGG + Intergenic
1045876533 8:106987901-106987923 GAGTAAAGATGGATGATGATAGG + Intergenic
1046052394 8:109039340-109039362 ATAAATGGATGGATGATGAATGG + Intergenic
1046925218 8:119779754-119779776 GTGAAAAGATAGATGTTGAGGGG - Intronic
1047228841 8:122978950-122978972 GTGAATGGATGGATAATAGATGG + Intergenic
1047228846 8:122978991-122979013 ATGAATAGACGGATGATGGATGG + Intergenic
1047306773 8:123659033-123659055 CTGAATGAATGGATGATGGATGG - Intergenic
1047306780 8:123659071-123659093 ATGGATAGATGGATGATGGATGG - Intergenic
1047306783 8:123659090-123659112 ATGGATGGATGGATGATGGATGG - Intergenic
1047306789 8:123659120-123659142 GTGGATAGATGGATGATGGATGG - Intergenic
1047306801 8:123659187-123659209 ATGGATAGATGGATGATGGATGG - Intergenic
1047306804 8:123659206-123659228 ATGGATGGATGGATGATGGATGG - Intergenic
1047306847 8:123659416-123659438 ATGAATTGATGGAGGATGGATGG - Intergenic
1047306854 8:123659453-123659475 GTGGATGGATAGATGATGGATGG - Intergenic
1047306871 8:123659547-123659569 ATGAATGGATAGATGATGGATGG - Intergenic
1047306896 8:123659740-123659762 ATGGATGGATGGATGATGGATGG - Intergenic
1047306905 8:123659779-123659801 ATGAATGGATAGATGATGGATGG - Intergenic
1047306932 8:123659939-123659961 ATGTATGGATAGATGATGAATGG - Intergenic
1047306943 8:123660026-123660048 ATGGATGGATGGAGGATGAATGG - Intergenic
1047428260 8:124766419-124766441 GTGAGCAAATGAATGATGAATGG + Intergenic
1047703913 8:127478431-127478453 GTGAATAAATGAATGAATAATGG - Intergenic
1048175370 8:132147631-132147653 ATGAATGGATGGATGAAGATGGG + Intronic
1048176772 8:132159842-132159864 ATGAATGGGTGGATGATGGATGG - Intronic
1048196728 8:132337561-132337583 ATGAATATATGAATGAAGAAGGG + Intronic
1048200010 8:132364709-132364731 ATGGATGGATGGACGATGAATGG + Intronic
1048289839 8:133172288-133172310 ATGAATGAATGGATGATGGATGG - Intergenic
1048296970 8:133221535-133221557 ATGAATAGGTGGATGATGGATGG + Intronic
1048323417 8:133419825-133419847 TTGAATAGAGACATGATGAATGG + Intergenic
1048979784 8:139697087-139697109 GTGAACAGATGGATGGTGGATGG + Intronic
1048979802 8:139697172-139697194 GTGGACAGATGGATGGTGGATGG + Intronic
1048989285 8:139751909-139751931 GTGGATAGATGGATGGTGGATGG - Intronic
1048989414 8:139752536-139752558 GTGGATAGATGGATGGTGGATGG - Intronic
1049042168 8:140120758-140120780 ATGAATGGATGGATGTTGGATGG - Intronic
1049042180 8:140120831-140120853 ATGGATGGATGGATGATGGATGG - Intronic
1049233416 8:141495941-141495963 ATGACTGGATGGATGGTGAAAGG - Intergenic
1049348282 8:142150545-142150567 GTGGATGGATGGAAGATGAGTGG + Intergenic
1049350699 8:142163011-142163033 ATGTATAGATGGAGGATGGATGG + Intergenic
1049350868 8:142163934-142163956 GTGGATGGATGGAGGATGGATGG + Intergenic
1049359854 8:142207278-142207300 GTGAGTGGATGGATGGGGAATGG + Intergenic
1049359965 8:142207696-142207718 ATGAATAGATGGGGGATGGAAGG + Intergenic
1049364221 8:142228950-142228972 ATGGATAGATGGGTGATGAATGG + Intronic
1049364285 8:142229221-142229243 GTGGATGGATGGATGATGGATGG + Intronic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049428499 8:142548509-142548531 GTGGATGGATGGATGGTGGATGG + Intergenic
1049464418 8:142744455-142744477 GTGGATAGATGGGGGATGGATGG + Intergenic
1049464985 8:142746985-142747007 GTGGATGGATGGATGGTGGATGG + Intergenic
1049474805 8:142791914-142791936 ATGGATGGATGGATGATGAATGG - Intergenic
1049474910 8:142792614-142792636 ATGGATGGATGAATGATGAATGG - Intergenic
1051182889 9:14429598-14429620 GAGAATTGAGGGATGATGAAGGG - Intergenic
1051340363 9:16104649-16104671 ATGGATGGATGGATGATGATGGG - Intergenic
1052617528 9:30860816-30860838 GTGGATAGATGGGTGATGGATGG + Intergenic
1053799833 9:41757391-41757413 GGAGATAGATGGATGATGAATGG + Intergenic
1053799929 9:41757776-41757798 GGGGATAGATGGATGATGAATGG + Intergenic
1054145256 9:61557055-61557077 GGGGATAGATGGATGATGAATGG - Intergenic
1054145329 9:61557351-61557373 GGGGATAGATGGATGATGAATGG - Intergenic
1054145341 9:61557396-61557418 GGGAATAGATGGATGCTGAATGG - Intergenic
1054145378 9:61557542-61557564 GGAGATAGATGGATGATGAATGG - Intergenic
1054188241 9:61969446-61969468 GGAGATAGATGGATGATGAATGG + Intergenic
1054188275 9:61969583-61969605 GGGAATAGATGGATGCTGAATGG + Intergenic
1054188287 9:61969628-61969650 GGGGATAGATGGATGATGAATGG + Intergenic
1054188360 9:61969924-61969946 GGGGATAGATGGATGATGAATGG + Intergenic
1054451871 9:65407606-65407628 GTGTGTAGATGGATAATGAGGGG - Intergenic
1054451886 9:65407681-65407703 GTGTGTAGATGGATGGTGAGGGG - Intergenic
1054454305 9:65421712-65421734 ATGGGTAGATGGATGATGAATGG + Intergenic
1054454368 9:65422006-65422028 ATGCATGGATGGATGATGGATGG + Intergenic
1054458885 9:65451346-65451368 ATGGATGGATGGATGATGGATGG + Intergenic
1054464944 9:65487924-65487946 GGGGATAGATGGATGATGAATGG - Intergenic
1054465012 9:65488208-65488230 GGGGATAGATGGATGATGAATGG - Intergenic
1054465085 9:65488504-65488526 GGGGATAGATGGATGATGAATGG - Intergenic
1054465097 9:65488549-65488571 GGGAATAGATGGATGCTGAATGG - Intergenic
1054465122 9:65488659-65488681 GGAGATAGATGGATGATGAATGG - Intergenic
1054650165 9:67618697-67618719 GGGGATAGATGGATGATGAATGG - Intergenic
1054650216 9:67618913-67618935 GTGGATAGATGGATAATGGGTGG - Intergenic
1054650227 9:67618948-67618970 GGGGATAGATGGATGATGAATGG - Intergenic
1054650239 9:67618993-67619015 GGGAATAGATGGATGCTGAATGG - Intergenic
1054650273 9:67619130-67619152 GGAGATAGATGGATGATGAATGG - Intergenic
1055422189 9:76155617-76155639 ATGGAGGGATGGATGATGAATGG + Intronic
1055448089 9:76403196-76403218 GTGAATGAATGGATGAAGGAAGG - Intergenic
1055520634 9:77077294-77077316 GTGAATGGAAGGATCATCAATGG - Intergenic
1056124645 9:83523141-83523163 GTGAATGGATGGAGGATGGATGG + Intronic
1057181136 9:93031100-93031122 ATGGATGGATGGATGATGGATGG + Intronic
1057297512 9:93858011-93858033 ATGGATAGGTGGATGATGGATGG + Intergenic
1059252236 9:112895828-112895850 GTGGATGGATGGATGATGGGTGG - Intergenic
1059409070 9:114120725-114120747 ATAGATAGATGGATGATGAATGG + Intergenic
1059409082 9:114120795-114120817 CTGGATAGATAGATGATGGATGG + Intergenic
1059409089 9:114120826-114120848 ATGGATGGATGGATGATGGATGG + Intergenic
1059416540 9:114166076-114166098 ATGAATGGATGGATAATGACTGG - Intronic
1059635891 9:116170557-116170579 GTTAATAGATGGGTAATGGATGG - Intronic
1059766013 9:117384827-117384849 GTGAATGGATGTTGGATGAAGGG + Intronic
1059783723 9:117557431-117557453 CTGAATAAATGCTTGATGAATGG - Intergenic
1060040926 9:120300286-120300308 GTCAGTGGATGGATGATGGATGG + Intergenic
1061244643 9:129395148-129395170 GAGGATAGATGGAGGATGGATGG + Intergenic
1061244695 9:129395437-129395459 AGGAATAGATGAAAGATGAATGG + Intergenic
1061244708 9:129395496-129395518 GTGAATGAATGGAAGATGGATGG + Intergenic
1061244747 9:129395704-129395726 GAGAATGGATGGAGGATGGATGG + Intergenic
1061256511 9:129456711-129456733 CTGGATGGATGGATGATGGATGG + Intergenic
1061417482 9:130454941-130454963 ATGGATAGATGGATGATGGATGG - Intronic
1061417498 9:130455025-130455047 ATGAATGGATGGATGATGGATGG - Intronic
1061417513 9:130455109-130455131 ATGAATAAATGGATGATGGATGG - Intronic
1061417544 9:130455297-130455319 ATGGATGGATGGATAATGAAGGG - Intronic
1061417565 9:130455409-130455431 GTGAATGGATGAAGGATGGATGG - Intronic
1061950523 9:133933489-133933511 ATGGATGGATGGATGGTGAATGG + Intronic
1061950525 9:133933504-133933526 GTGAATGGATGGATGAATGATGG + Intronic
1061950562 9:133933673-133933695 ATGGATAGATGAATGATGGATGG + Intronic
1061950652 9:133934063-133934085 ATGGATAGATGGATGGTGAGTGG + Intronic
1061980956 9:134103395-134103417 GTGGATGGATGGATGCTGGATGG - Intergenic
1061980970 9:134103458-134103480 GTGGATGGATGGATGGTGGATGG - Intergenic
1061980976 9:134103480-134103502 GTGGATGGATGGATGCTGGATGG - Intergenic
1061981029 9:134103735-134103757 ATGGATAGATGGATGCTGGAAGG - Intergenic
1061981051 9:134103842-134103864 ATGGATAGATGGATGCTGGATGG - Intergenic
1061981081 9:134103991-134104013 GTGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092377 9:134685204-134685226 GTGAATGGATGGTGGATGGATGG - Intronic
1062092395 9:134685286-134685308 GTGGATGGATGGATGGTGGATGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092410 9:134685352-134685374 GTGAATGGATGGTGGATGGACGG - Intronic
1062092464 9:134685599-134685621 GTGGATGGATGGATGATGGATGG - Intronic
1062092467 9:134685614-134685636 GTGGATGGATGGATGGTGGATGG - Intronic
1062092819 9:134687451-134687473 ATGGATGGATGGATGATGGATGG - Intronic
1062172274 9:135141596-135141618 GATGATAGATGGATGATGGACGG + Intergenic
1062172311 9:135141822-135141844 ATGGATGGATGGGTGATGAATGG + Intergenic
1062201296 9:135304213-135304235 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201322 9:135304337-135304359 GTGGATAGATGGATGATGGAGGG + Intergenic
1062201333 9:135304390-135304412 GTGGATAGATGAATGATGGAGGG + Intergenic
1062201344 9:135304439-135304461 ATGGATAGATGGATGATGGAGGG + Intergenic
1062201359 9:135304496-135304518 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201373 9:135304549-135304571 GTGGATGGATGGATGATGGAGGG + Intergenic
1062201395 9:135304648-135304670 GTGGATAGATGGATGATGGAGGG + Intergenic
1062205471 9:135334389-135334411 ATAAATGGATGGATGATGGATGG + Intergenic
1062247979 9:135579411-135579433 GTGAATAAATGGATGGTGTATGG - Intergenic
1062281261 9:135752767-135752789 GTGGATGGGTGGATGATGGATGG + Intronic
1062281291 9:135752904-135752926 ATGAGTGGATGGATGATGGATGG + Intronic
1062520839 9:136957247-136957269 GTGGATGGATGGATGATGGGTGG + Intronic
1062665411 9:137668450-137668472 GTGAATAGATGGATGTGGACAGG - Intronic
1185581128 X:1212156-1212178 GTGGATGGATGGGTGATTAATGG + Intronic
1185582291 X:1219556-1219578 GTACATAGATAGATGATGGATGG + Intergenic
1185611417 X:1395602-1395624 ATGGATGGATGGATGATGGATGG + Intergenic
1185611419 X:1395617-1395639 ATGGATGGATGGATAATGAATGG + Intergenic
1185611474 X:1395892-1395914 GTGGGTGGATGGATAATGAATGG + Intergenic
1185611484 X:1395971-1395993 ATGGATGGATGGATAATGAATGG + Intergenic
1185613150 X:1403917-1403939 GTGAATAGATGGTAGATGATGGG + Intronic
1185613163 X:1403996-1404018 GTGAATAGATGGTACATGATGGG + Intronic
1185613175 X:1404067-1404089 GTGAATAGATGGTACATGATGGG + Intronic
1185613187 X:1404138-1404160 GTGAATAGATGGTAGATGATGGG + Intronic
1185613198 X:1404209-1404231 GTGAATAGATGGTAGATGATGGG + Intronic
1185613212 X:1404292-1404314 GTGAATAGATGGTAGATCATGGG + Intronic
1185613221 X:1404367-1404389 GTGAATAGATGGTAGATGATGGG + Intronic
1185613269 X:1404664-1404686 GTGAATAGATGGTAGATGATGGG + Intronic
1185613302 X:1404889-1404911 GTGAATAGATGGTAGCTGATGGG + Intronic
1185613315 X:1404968-1404990 GTGAATAGATGGTAGATGATGGG + Intronic
1185613323 X:1405026-1405048 ATGAATAGATGGTAGATGATGGG + Intronic
1185613342 X:1405176-1405198 GTGAATAGATGGTAGATGATGGG + Intronic
1185613351 X:1405238-1405260 GTGAACAGATGGTAGATGATGGG + Intronic
1185613402 X:1405588-1405610 GTGAATAGATGGTAGATGATGGG + Intronic
1185613414 X:1405667-1405689 GTGAATAGATGGTACATGATGGG + Intronic
1185613426 X:1405746-1405768 GTGAATAGATGGTAGATGATGGG + Intronic
1185613437 X:1405817-1405839 GTGAATAGATGGTAGCTGATGGG + Intronic
1185613449 X:1405892-1405914 GTGAATAGATGGTAGATGATGGG + Intronic
1185613467 X:1406021-1406043 GTGAATAGATGGTAGACGATGGG + Intronic
1185613492 X:1406161-1406183 CTGAATAGATGGTAGATGATGGG + Intronic
1185613501 X:1406220-1406242 GTGAATAGATGGTAGATGATGGG + Intronic
1185613513 X:1406291-1406313 GTGAATAGATGGTAGATGATGGG + Intronic
1185613525 X:1406362-1406384 GTGAATAGATGGTAGATGATGGG + Intronic
1185613540 X:1406445-1406467 GTGAATAGATGGTAGATGATGGG + Intronic
1185613548 X:1406520-1406542 TTGAATAGATGGTAGATGATGGG + Intronic
1185613578 X:1406728-1406750 GTGAATAGATGGTAGATGATGGG + Intronic
1185613601 X:1406882-1406904 GTGAATAGATGGTAGATGATGGG + Intronic
1185613608 X:1406949-1406971 GTGAATAGATAGTAGATGATGGG + Intronic
1185613619 X:1407016-1407038 GTGAATAGATGGTAGATGATGGG + Intronic
1185613650 X:1407210-1407232 GTGAATAGATGGTAGATGATGGG + Intronic
1185613685 X:1407433-1407455 GTGAATAGATGGTAGATGATAGG + Intronic
1185613695 X:1407508-1407530 GTGAATATATGGTAGATGATGGG + Intronic
1185616177 X:1423624-1423646 ATGCATAGATGAGTGATGAATGG - Intronic
1185622382 X:1460137-1460159 TAGAATAGATAGATGATAAATGG - Intergenic
1185624506 X:1472887-1472909 GTTGGTGGATGGATGATGAATGG + Intronic
1185624608 X:1473289-1473311 GGGGTTGGATGGATGATGAATGG + Intronic
1185624710 X:1473732-1473754 GTGGGTGGATGGATGATGAATGG + Intronic
1185624839 X:1474250-1474272 GTGAGTGGATGGAGGATGAATGG + Intronic
1185624884 X:1474463-1474485 GTGAATGGATGTATGATGAATGG + Intronic
1185624936 X:1474700-1474722 GTGAATGGATGTATGATGAATGG + Intronic
1185624944 X:1474745-1474767 GTGAATGGATGTATGATGAATGG + Intronic
1185624998 X:1474998-1475020 GTGAATGGATGTATGAGGAATGG + Intronic
1185660416 X:1723784-1723806 ATGAATAGATAGATGATAGATGG + Intergenic
1185660425 X:1723929-1723951 ATGAATAGATAGATGATAGATGG + Intergenic
1185744351 X:2560048-2560070 ATGTATATATGGATGATGGATGG + Intergenic
1185744369 X:2560179-2560201 ATGGATATATGGATGATGGATGG + Intergenic
1185780559 X:2840942-2840964 ATGGATAGATAGATGATGGATGG + Intronic
1185925879 X:4145402-4145424 ATGGATGGATGGATGATGAATGG + Intergenic
1186055576 X:5646178-5646200 ATGGATGGATGGATGATGGATGG - Intergenic
1186150436 X:6669193-6669215 ATGGATAGATTGATGATGGATGG + Intergenic
1186166609 X:6833248-6833270 GTAGATGGATGGATGAAGAAAGG + Intergenic
1186338993 X:8623017-8623039 ATGGATGGATGGATGATGGATGG + Intronic
1186724727 X:12345039-12345061 GTGGGTAGATGGATAATGGATGG + Intronic
1187119388 X:16388848-16388870 ACGGATAGATGGATGATAAAAGG + Intergenic
1188360438 X:29246406-29246428 ATGACTAGAAGGATGATGAGAGG - Intronic
1188810255 X:34645262-34645284 GTGAATAGATGGATAATTTAGGG - Intronic
1188974800 X:36660354-36660376 GAGAATAGAAGGATGGTGACCGG + Intergenic
1189279890 X:39813621-39813643 CTGAGTAGATGGATGTTGCATGG + Intergenic
1189723310 X:43942856-43942878 GAGAATAATTGGATGATGAGAGG + Intergenic
1190155539 X:47988983-47989005 GTGAAAAGTTTGATGAAGAATGG + Intronic
1190262446 X:48805941-48805963 GTGAATAGATGGTGGATGTGTGG + Intronic
1192627584 X:72746191-72746213 GTGAATGGATGTATCATGGATGG - Intergenic
1192654124 X:72974622-72974644 GTGAATGGATGTATCATGGATGG + Intergenic
1193200327 X:78682305-78682327 ATGGATAGATGAGTGATGAATGG - Intergenic
1193698693 X:84739190-84739212 GTGGAGAGATGGATGGTCAAGGG - Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1194620994 X:96171660-96171682 GTGAATAAATGTATGATCAAAGG + Intergenic
1197800646 X:130344391-130344413 CTGAAAAGATTGATGATGACAGG + Intronic
1200254955 X:154575678-154575700 GTAAATATATGAATGATGTAGGG + Intergenic
1200262814 X:154628730-154628752 GTAAATATATGAATGATGTAGGG - Intergenic
1200781560 Y:7220903-7220925 GAAAATAGATTGATGATGGATGG + Intergenic
1200781588 Y:7221144-7221166 GTGAGTGGTTGGGTGATGAAGGG + Intergenic
1200781947 Y:7224701-7224723 ATGGATAGATGGGTGATGGATGG - Intergenic
1201289494 Y:12408923-12408945 ATGGATAGATAGATGATGGATGG - Intergenic
1201289501 Y:12409055-12409077 ATGGATAGATAGATGATGGATGG - Intergenic
1201291486 Y:12424776-12424798 GACGATAGATGGATGATGGATGG + Intergenic
1201373284 Y:13288595-13288617 GTGATTAGAAAGATAATGAATGG + Intronic
1201923597 Y:19261059-19261081 GTGAATTGCTGGAAGATCAAAGG - Intergenic