ID: 1075920873

View in Genome Browser
Species Human (GRCh38)
Location 10:126211600-126211622
Sequence GAGGTAGAGATGACTACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 147}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075920873 Original CRISPR GAGGTAGAGATGACTACTGG AGG (reversed) Intronic
902711524 1:18243270-18243292 GAGGTGGAGAAGACTAAGGGAGG - Intronic
907284385 1:53370724-53370746 GAGGTAAAGCTGACTGCTGCTGG - Intergenic
908237664 1:62162610-62162632 AAGGGAGAGATGCTTACTGGTGG + Exonic
908288112 1:62631239-62631261 GAAGTAGAAATCAGTACTGGAGG - Exonic
911554137 1:99322250-99322272 GAAGCAGAGATGGTTACTGGAGG + Intergenic
911903338 1:103532354-103532376 GAAATAGAGATGGCTCCTGGTGG + Intronic
916011282 1:160708133-160708155 CAGGGAAAGATGACGACTGGGGG + Intronic
919994110 1:202731927-202731949 GAGGTTGAGATACCTAATGGAGG + Exonic
921503150 1:215931618-215931640 GAGGTTGAGATGAGGCCTGGAGG + Intronic
923988900 1:239412353-239412375 GAAGGATAGATGACTCCTGGAGG - Intronic
924832016 1:247606213-247606235 GAGATGGAGATGAGTGCTGGTGG - Exonic
1069555436 10:69394719-69394741 CAGGTAGACATGAATGCTGGTGG + Intronic
1069819341 10:71217841-71217863 GAGGTGGAGATGGGGACTGGGGG - Intronic
1070032212 10:72688001-72688023 GATGAAGAGATGACTGCAGGTGG + Intergenic
1070177110 10:73980221-73980243 GAGGATGAGATGACCACTGCAGG - Intergenic
1071246330 10:83768964-83768986 GAGCTGGAGATAACTAGTGGAGG + Intergenic
1071692761 10:87839717-87839739 GAGATGGAGAAGATTACTGGGGG - Intronic
1073055545 10:100698421-100698443 AAGGAAGAGATCACTACTGTTGG - Intergenic
1075920867 10:126211556-126211578 AAGGCAGAGATGACTACTAGCGG - Intronic
1075920873 10:126211600-126211622 GAGGTAGAGATGACTACTGGAGG - Intronic
1075920890 10:126211732-126211754 GAGGCAGAGATGACTATTTGCGG - Intronic
1080289799 11:30658292-30658314 GAAGAACAGATGACAACTGGGGG - Intergenic
1082966332 11:58969592-58969614 GAGTTTGAGATGGCTACTGGAGG + Intronic
1083209784 11:61176058-61176080 GTGGTAGAGATGCTTACTGCTGG - Intergenic
1083447824 11:62721579-62721601 TAGATAGAAATGACTACTGCAGG - Intronic
1083993432 11:66260302-66260324 GAGGTAGAGAGGACCACTCAGGG + Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1086229614 11:84552518-84552540 GAGGTGTAGATGACTGATGGAGG - Intronic
1088315861 11:108505844-108505866 GAGGTAAATATGTGTACTGGAGG - Exonic
1089961284 11:122618974-122618996 GGGGCAGACATGACTACTCGGGG + Intergenic
1091035988 11:132234037-132234059 GAGGCAGAGATGACTAGTCAGGG - Intronic
1101640716 12:106584205-106584227 GAGGTGGCGAAAACTACTGGAGG - Intronic
1112639797 13:101260021-101260043 GAGGCTGAGATGGGTACTGGGGG - Intronic
1113900386 13:113793671-113793693 GAGGAAGAGCTGTCAACTGGGGG - Intronic
1115727651 14:36234827-36234849 GAGGGAGAGAGGACTACTGAAGG - Intergenic
1118344141 14:64922804-64922826 GAGGAAGAGATTAATTCTGGTGG - Intronic
1119800640 14:77441944-77441966 GAGGTAGGCATGTCTGCTGGGGG - Intronic
1120361831 14:83514164-83514186 GAAGTACAGATAAATACTGGGGG - Intergenic
1123424220 15:20156135-20156157 AAGGCAGAGTTGACCACTGGAGG + Intergenic
1123533441 15:21162664-21162686 AAGGCAGAGTTGACCACTGGAGG + Intergenic
1128544335 15:68557036-68557058 AAGGTAGAGATGGCTATTGCTGG + Intergenic
1130448279 15:84025018-84025040 CATGTAGAGATGACTACTTTAGG - Intronic
1131322503 15:91408148-91408170 GAGGTAGAGATCTCTGCTTGAGG + Intergenic
1131768345 15:95705703-95705725 GAGGGGGAGAAAACTACTGGAGG - Intergenic
1134057349 16:11178792-11178814 GTGGTTGAGATGGCTGCTGGGGG - Exonic
1134341615 16:13351941-13351963 GAGGGAGAAATGACAACAGGTGG + Intergenic
1136860643 16:33699752-33699774 AAGGCAGAGTTGACCACTGGAGG - Intergenic
1138455189 16:57116903-57116925 GAGGGAGAGAGGCCTACAGGGGG + Intronic
1144290712 17:13823471-13823493 GAGGTAGAGATGGGTAGTTGAGG - Intergenic
1145995744 17:29103826-29103848 GACATAGAGATGACTACGAGAGG + Intronic
1150639235 17:66938539-66938561 TAGGGAGAGATGACAACAGGGGG - Intergenic
1150969101 17:70006699-70006721 GAGGTAGAGATGACTTTAGAAGG + Intergenic
1153453702 18:5258182-5258204 GAAGTAGAGGTGATTACTGTGGG - Intergenic
1153774815 18:8443062-8443084 GGGGTAGAGATCAGAACTGGTGG + Intergenic
1155089593 18:22493725-22493747 GAGGTAGAGATAATTAGTGGTGG - Intergenic
1156992680 18:43428712-43428734 GAGGAAGGGATCATTACTGGTGG + Intergenic
1162516533 19:11151529-11151551 GGGGTAGAGATTACTACTCAGGG - Intronic
1163080881 19:14941289-14941311 GATGTAGAGATGACTTCTCCAGG + Intergenic
1166706513 19:44911011-44911033 GGGGTAGACATCACAACTGGAGG - Intergenic
1167244098 19:48363605-48363627 GGGGTAGAGACGGCTTCTGGAGG - Intronic
1168452354 19:56476424-56476446 GAGGTAGTGGTGAATACTGGAGG - Intronic
925831518 2:7900641-7900663 GTGGTAGAGAAGACTCCAGGAGG - Intergenic
930450196 2:51526222-51526244 GAGGTACAGAGGTCAACTGGTGG - Intergenic
930689550 2:54346543-54346565 GAGATGGAGAAGACTAGTGGAGG - Intronic
934459024 2:94200904-94200926 AAGGCAGAGTTGACCACTGGAGG - Intergenic
935197591 2:100827548-100827570 CAGGTACTGAAGACTACTGGAGG - Intronic
935455588 2:103264225-103264247 GAGGTAGTGATGACCACAGTTGG - Intergenic
936243195 2:110805844-110805866 GAGGCAGAGATGGCTCCTGGAGG - Intronic
938820807 2:134957936-134957958 GAACTAGAAATGACTACTTGAGG + Exonic
939120652 2:138112223-138112245 GAGGGAGAGTTGATTTCTGGTGG - Intergenic
939953725 2:148507059-148507081 GAGGGAGAAATGACTACTTTTGG - Intronic
944182951 2:196915490-196915512 GAGGTAGGGAAGAATACAGGAGG - Intronic
944711100 2:202335898-202335920 GGGGTACTGATGACTCCTGGGGG + Intergenic
947046419 2:225991913-225991935 GAGGTAGAGAAGAATTCTGGGGG + Intergenic
1174531622 20:51219115-51219137 GAGACAGAAATGACTGCTGGTGG + Intergenic
1175007919 20:55705316-55705338 GTGGTAGAGATGAATATTGGGGG + Intergenic
1175984174 20:62755764-62755786 GAGGGAGAGATGATGGCTGGAGG - Intronic
1176708153 21:10130147-10130169 CAGGTAGACATGACTCCAGGCGG - Intergenic
1176717852 21:10368478-10368500 CTGGTAGAGATGACTTTTGGGGG - Intergenic
1177245062 21:18512542-18512564 GAGTTAAAAATGACTACTGTTGG + Intergenic
1177553439 21:22656702-22656724 AAGCTATAGATTACTACTGGGGG + Intergenic
1179840308 21:44068284-44068306 CAGGTAGATGTGACTGCTGGTGG + Intronic
1180076174 21:45464230-45464252 GAGGAAGAGATGAAAACGGGAGG - Intronic
1180299078 22:11021384-11021406 CTGGTAGAGATGACTTTTGGGGG - Intergenic
1181357191 22:22305565-22305587 AAGGCAGAGTTGACCACTGGAGG + Intergenic
1184092230 22:42298888-42298910 GAGGCAGGGATGGCTCCTGGAGG - Intronic
949822937 3:8135438-8135460 GTGGAAGAGGTGACTCCTGGGGG + Intergenic
955970158 3:64431022-64431044 GAGATACAGAGGACTACTAGAGG + Intronic
956515008 3:70037037-70037059 GAGGTTGAGATTAGTACAGGAGG + Intergenic
959259478 3:104056993-104057015 GAGGTTGAGAAGAATACTGGAGG + Intergenic
959623056 3:108419772-108419794 GAAATAGAGGTGTCTACTGGAGG + Intronic
960938979 3:122921429-122921451 GAGGTAGAGAGGGCTGCTGCAGG - Intronic
962265727 3:133943007-133943029 GAGGCAGATATGACTTCTGGAGG - Intronic
964474478 3:157086151-157086173 CAGGAAGTGATGATTACTGGGGG + Intergenic
966224735 3:177585800-177585822 GAGGCAGAAATGACAGCTGGAGG + Intergenic
966306097 3:178536611-178536633 GAGGTAATGATGATTACCGGTGG + Intronic
967134602 3:186502776-186502798 GGGGTAGAGATGACTGAAGGGGG - Intergenic
967214947 3:187201850-187201872 GAGGAAGAAATGAATACTGTGGG + Intergenic
969255298 4:5997193-5997215 AAGGTAGAAATGGTTACTGGTGG + Intergenic
969565653 4:7976004-7976026 GTGGGAAAGATGACTGCTGGTGG - Intronic
970464941 4:16312943-16312965 AAGGTAGACATGAATTCTGGGGG + Intergenic
976602655 4:86952267-86952289 CAGTTAGAGTTGACTACTGTAGG + Intronic
978159220 4:105526554-105526576 GGGGTACTGATGACTCCTGGGGG + Intergenic
978283256 4:107042506-107042528 GACGTAGGGATGACCACAGGAGG - Intronic
980191469 4:129530231-129530253 GAGATGGAGAAGACTTCTGGAGG - Intergenic
980564389 4:134519755-134519777 GAGTGAGAGCTGACTAGTGGAGG + Intergenic
984587288 4:181578735-181578757 CAGGCAGAGATGACCACAGGAGG - Intergenic
986028786 5:3875834-3875856 GGGGTAGGGATGACTTCAGGAGG - Intergenic
988264710 5:28932679-28932701 AAGTTAGACATCACTACTGGGGG - Intergenic
990061448 5:51654485-51654507 GAGGGAGCTATGACTACTGGAGG - Intergenic
994234521 5:97345799-97345821 GAGGGTGAGATGAGTAATGGGGG - Intergenic
996748676 5:126868052-126868074 GAGGAAGAGATGAGGAGTGGGGG - Exonic
999616871 5:153434164-153434186 GAGGTGGAGGGGACTGCTGGAGG - Intergenic
1001546864 5:172575617-172575639 GAGGTTGAGAAGTCTACTCGTGG - Intergenic
1006119265 6:31794444-31794466 GAGGGAGAGATGACAATTGCTGG - Intronic
1007766817 6:44165622-44165644 GAGGTTGAGGAGACTGCTGGAGG + Intronic
1007944930 6:45817640-45817662 GAGAAAAAGAAGACTACTGGGGG - Intergenic
1008333439 6:50270874-50270896 GAGGGAGTGATGACTCCTGTTGG - Intergenic
1008731895 6:54492447-54492469 GAGGTAGAGATAGCAACTGTGGG - Intergenic
1011750807 6:90452961-90452983 GAGATAGAGAAGACTGGTGGAGG + Intergenic
1011873249 6:91923850-91923872 GAGGCTGAGAAGAGTACTGGAGG + Intergenic
1011875860 6:91960661-91960683 GAGGTACAAACAACTACTGGAGG + Intergenic
1016572346 6:145529139-145529161 GAGATAGAGACTACTCCTGGTGG + Intronic
1017809032 6:157970816-157970838 GAGGGAGAGATGAGTGCTGTGGG + Intergenic
1017810392 6:157980041-157980063 AGGGCAGAGATGACTATTGGTGG + Intergenic
1017945850 6:159095761-159095783 GAGGAAGAGGTGCCTCCTGGTGG + Intergenic
1018743046 6:166744696-166744718 GAGGAGGAGATGACACCTGGGGG + Intronic
1019886248 7:3908610-3908632 GAGGTTGAGATGAGTACTTGCGG - Intronic
1020433694 7:8139520-8139542 GAGGGAGGGATGAATAGTGGAGG + Intronic
1024548135 7:50539251-50539273 GAGGTAGAGCTGCCTGCTGATGG - Intronic
1025790814 7:64685387-64685409 GAGGTGCTGATGACTTCTGGGGG - Intronic
1026466076 7:70655764-70655786 GAGAAAGGGATGGCTACTGGGGG + Intronic
1026610149 7:71851281-71851303 GAGGCCGAGATGACCACTTGAGG + Intronic
1027878506 7:83801952-83801974 GAGGTAGTGATGAGCGCTGGGGG + Intergenic
1030918306 7:115345737-115345759 GTGGTAGAGAAGACTATTTGGGG - Intergenic
1032953840 7:136947982-136948004 GAGGGAGAGATGACTTCTGGTGG + Intronic
1033124425 7:138695383-138695405 CAGGTAGCGAGGACTACAGGTGG - Intronic
1036207167 8:6813955-6813977 GAGGTATAGCTGAGTCCTGGGGG - Intronic
1036451142 8:8868786-8868808 GAAGTAGCGATGACTATGGGTGG - Intronic
1039041219 8:33410460-33410482 GAGGAGGAGCTGCCTACTGGTGG + Intronic
1039343158 8:36673145-36673167 GAGGTAGAATTGGGTACTGGGGG - Intergenic
1041469182 8:58190040-58190062 GAGGTAGAAAGAACAACTGGAGG + Intronic
1044772285 8:95648956-95648978 GAGATAGAGGTGGATACTGGTGG - Intergenic
1045829212 8:106437940-106437962 GATGTAAAGAAAACTACTGGGGG + Intronic
1046823542 8:118661894-118661916 GGGGTAGAGATGGCCAGTGGTGG + Intergenic
1049162593 8:141106761-141106783 GAGTGAGAGGTGACTGCTGGCGG - Intergenic
1053645116 9:40115661-40115683 CAGGTAGACATGACTCCAGGCGG - Intergenic
1053760602 9:41347867-41347889 CAGGTAGACATGACTCCAGGCGG + Intergenic
1054326139 9:63713559-63713581 CAGGTAGACATGACTCCAGGTGG - Intergenic
1054539457 9:66260310-66260332 CAGGTAGACATGACTCCAGGCGG + Intergenic
1056722182 9:89081911-89081933 GAGGTAGGGATGACTGCAGGGGG + Intronic
1057032293 9:91785131-91785153 GAGGGAGAGATGAGGAGTGGAGG - Intronic
1057752841 9:97805896-97805918 TTGGTAGAAATGGCTACTGGAGG + Intergenic
1058035379 9:100246779-100246801 GAGGTACAGGTGAGAACTGGTGG + Exonic
1061923637 9:133795481-133795503 GAGGTAGAGGTGACGGGTGGAGG - Intronic
1062239757 9:135530334-135530356 GAGGCAGAGCTGACAGCTGGAGG - Intergenic
1202792916 9_KI270719v1_random:99116-99138 CAGGTAGACATGACTCCAGGCGG - Intergenic
1189180693 X:39001873-39001895 TAGGTAGAGATGGCTGCTTGAGG + Intergenic
1189546849 X:42050548-42050570 GTGGTAGAAATGACTACTTGTGG + Intergenic
1195233867 X:102877915-102877937 GAGGTAGAGGTGATCCCTGGAGG + Intergenic
1195301067 X:103530423-103530445 GAGGTAGAGGTGATCCCTGGAGG - Intergenic
1195479756 X:105330717-105330739 GAGGCAGAGTTGACTACTTAAGG - Intronic
1199585901 X:149415486-149415508 CTGGTAGAGAAGACTACTGTGGG - Intergenic
1199710157 X:150463260-150463282 GGGATAGAGATGATTACTGTGGG - Intronic