ID: 1075921952

View in Genome Browser
Species Human (GRCh38)
Location 10:126220923-126220945
Sequence GAAGCCTCTGGGCCTCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075921952_1075921957 8 Left 1075921952 10:126220923-126220945 CCACATGGAGGCCCAGAGGCTTC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1075921957 10:126220954-126220976 ATTCTGATCCCACCCCGTTAGGG No data
1075921952_1075921956 7 Left 1075921952 10:126220923-126220945 CCACATGGAGGCCCAGAGGCTTC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1075921956 10:126220953-126220975 CATTCTGATCCCACCCCGTTAGG No data
1075921952_1075921958 9 Left 1075921952 10:126220923-126220945 CCACATGGAGGCCCAGAGGCTTC 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1075921958 10:126220955-126220977 TTCTGATCCCACCCCGTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075921952 Original CRISPR GAAGCCTCTGGGCCTCCATG TGG (reversed) Intronic
900098411 1:949909-949931 CACGACTCTGGGCCTTCATGAGG + Intronic
900481445 1:2901412-2901434 GAAGCCGCTGAGACTCCTTGTGG + Intergenic
900567070 1:3338725-3338747 GCTGCCTCTGGGGCTCCAGGAGG - Intronic
901660880 1:10796912-10796934 GAAGCCTCTGGACCTGCAAAAGG - Intergenic
901954617 1:12775233-12775255 GAAGTCTCTGGGCCACCCTTGGG - Intronic
903292711 1:22324998-22325020 GAAGTGACTGGGCCTCCCTGGGG + Intergenic
904321069 1:29698165-29698187 CAAGCCTGTGAGCCTCCTTGTGG - Intergenic
904331315 1:29759310-29759332 TAAGCCTCTGGGTCCCAATGTGG + Intergenic
905972920 1:42154754-42154776 GGAGGCTCTGGGCCTGCAGGCGG - Exonic
906240947 1:44241991-44242013 GATGTCTCTGGGGCTCCAAGGGG + Intronic
906674006 1:47680052-47680074 GGAGCTGCTGGCCCTCCATGAGG - Intergenic
907666493 1:56437600-56437622 GAATTATCTTGGCCTCCATGTGG - Intergenic
908656598 1:66395014-66395036 GAAGCCTCAGGAACTCCCTGTGG - Intergenic
909162896 1:72176772-72176794 GAAGCCTCTATGCCTCGATAAGG + Intronic
910460614 1:87444656-87444678 CAAGCCTCACGGCTTCCATGTGG - Intergenic
911244713 1:95504186-95504208 GAAGCCTATAGGGCTGCATGGGG + Intergenic
911504986 1:98737731-98737753 TAATCCCCTGGGCCTCCAGGTGG + Intronic
914980614 1:152411370-152411392 GAAACATCTGGGCCTCAATGAGG - Intronic
915310951 1:155005572-155005594 GAAGCCTCTGGGCCTGCTGCGGG + Intronic
915581187 1:156814278-156814300 GCAGCCTCTCTGCCTCCCTGTGG + Exonic
915637973 1:157199622-157199644 GGAGCCTCTGGGCCCCAAGGCGG - Intergenic
915660860 1:157403838-157403860 GAAGACTCTGGGTGTCCCTGTGG + Intergenic
917115508 1:171599360-171599382 GAATCCCCTAGGGCTCCATGAGG - Intergenic
917839354 1:178964894-178964916 GTAGCCTCTCCCCCTCCATGTGG - Intergenic
918288964 1:183087706-183087728 GAAGCCTCTAGTCCTCTATTGGG - Intronic
918304068 1:183229698-183229720 CAAACCTCTGGGTCTTCATGAGG - Intronic
919909375 1:202101387-202101409 GAAGCCTGTGGGCTTCCACAGGG + Intergenic
920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG + Intronic
921384664 1:214556588-214556610 GACGCCTCTTGGACTCCACGTGG - Intergenic
922500151 1:226091281-226091303 GCAGGCTCTGTTCCTCCATGAGG - Intergenic
1066632404 10:37469898-37469920 GCTGCCTGTGGTCCTCCATGGGG + Intergenic
1066696610 10:38084685-38084707 GCAGACACTGGGCCTACATGAGG + Intergenic
1066995936 10:42563048-42563070 GCAGACACTGGGCCTACATGAGG - Intergenic
1067409548 10:46052545-46052567 GAAGCTTCCGGGCCTCCAAGGGG - Intergenic
1069889801 10:71645750-71645772 GGAGCCTCTGCTCCTCCATTTGG + Intronic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1071205340 10:83269333-83269355 GAAGAATCAGGGCCTACATGGGG + Intergenic
1071615101 10:87068033-87068055 GAAGCCTCGGGGCTTCCAGTGGG + Intronic
1072300086 10:94052149-94052171 CAAGCCTCTAGGTTTCCATGTGG - Intronic
1073116255 10:101093534-101093556 GAAGCCCCAGGGGCTCCATGGGG - Intronic
1073186335 10:101617403-101617425 CAAGCCTCTGGGCATCTGTGAGG - Intronic
1073809673 10:107138799-107138821 GAAGCCTCAGTGCCTCTACGCGG + Intronic
1075041825 10:119114079-119114101 AAACCCTCTGGGCCTCCTTCTGG - Intronic
1075614365 10:123880884-123880906 GATGTCTCTGGGCCTCAGTGAGG - Intronic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076529127 10:131132904-131132926 GAAGCCTGTGAGCCACTATGTGG - Intronic
1076662968 10:132067719-132067741 GTGGACTCTGGGCTTCCATGTGG + Intergenic
1076747117 10:132520028-132520050 GCTGCCTCTGGGCCCCCAGGCGG + Intergenic
1076889773 10:133277733-133277755 GGGGCCTCAGGGCCTCCCTGGGG + Intergenic
1077180253 11:1209068-1209090 CAAGACTCTGGCCCTGCATGGGG + Intergenic
1079130324 11:17743557-17743579 GCAGCCCCTGGGACTCCATATGG + Intronic
1079344141 11:19637269-19637291 GAAGTTTGTGGTCCTCCATGTGG - Intronic
1081535426 11:43992859-43992881 GAAGCCTCCTGGTCTGCATGTGG + Intergenic
1081577460 11:44328167-44328189 CAAGCCCCTGGGCCTCCGAGTGG + Intergenic
1081735726 11:45402181-45402203 GAGGCCTCTGAGCTGCCATGAGG - Intergenic
1083731458 11:64654613-64654635 GAAGCCTCTGGCCATCCCTCTGG + Intronic
1084062906 11:66687502-66687524 GATGGCTCTGGGCCTCGAGGCGG + Exonic
1084605528 11:70169657-70169679 GAGGCCTCTGGTCCTGCCTGAGG - Intronic
1085311913 11:75521941-75521963 GAAGCCTCTGTGGCTCCTTACGG - Intronic
1086306464 11:85485793-85485815 GATACCTGTGGGACTCCATGTGG - Intronic
1089386063 11:118068814-118068836 GATGCCGCTGGGCCTCTGTGGGG - Intergenic
1090182833 11:124716112-124716134 GTATCCTCTGGGCCTTCCTGGGG - Intergenic
1090441753 11:126730235-126730257 GGGGCCTGTGGGCCCCCATGTGG - Intronic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1090991098 11:131817665-131817687 GGGGCCTCTGAGCTTCCATGAGG + Intronic
1093337164 12:17920536-17920558 GATGCCTGTGGGATTCCATGTGG - Intergenic
1098597584 12:72292681-72292703 GAAGCCTCTGGGGCTTGAGGAGG - Intronic
1101571106 12:105954520-105954542 GGAGCCTCTGAGCCTCCAGAAGG - Intergenic
1101635941 12:106541333-106541355 TAGGCCTCTGGGCCTAGATGGGG + Intronic
1101729972 12:107418912-107418934 GAAGCCACTGGACTTTCATGGGG - Intronic
1102690170 12:114754133-114754155 AAAGCCTCAGAGCCTCCATTGGG - Intergenic
1104017712 12:124971678-124971700 GAAGCCACTGGGACTCCTGGGGG - Intronic
1104414092 12:128583711-128583733 GTGGCCACTGGGCCTCCATCTGG - Intronic
1104978355 12:132562007-132562029 CCAGCCTTTGGGCCTCCAGGGGG - Intronic
1107330702 13:39296541-39296563 CAAGCCTTGGGGCTTCCATGTGG + Intergenic
1107898473 13:44989214-44989236 GGAGAGACTGGGCCTCCATGGGG + Exonic
1110551254 13:76813616-76813638 CAAGCATGTGGGCCACCATGGGG + Intergenic
1112159181 13:96850540-96850562 GAAGTCTCTGTGCCTCCCTCGGG + Intergenic
1117070734 14:52053716-52053738 GAAGGCACTGGCCCTCCATCTGG + Exonic
1117737289 14:58780734-58780756 GGAGCCTCTGCGGATCCATGAGG + Intergenic
1121424113 14:93836062-93836084 CAGGTCTCAGGGCCTCCATGTGG + Intergenic
1122309268 14:100784238-100784260 GTAGCCCCTGGGCCTGGATGGGG - Intergenic
1122533159 14:102443167-102443189 GCAGCCTTTGGGCCTCCATCTGG + Intronic
1122866967 14:104610695-104610717 GAAGCCTCTGGGCCTACAGAAGG - Intergenic
1122906341 14:104803336-104803358 GAAGCCTCTGGGCATCCCCCAGG + Exonic
1125044418 15:35230124-35230146 GACGCCTCTGGACCTGCCTGGGG - Intronic
1125346463 15:38723715-38723737 GAAAGCTTTGGGTCTCCATGGGG + Intergenic
1126098466 15:45105738-45105760 CTGGGCTCTGGGCCTCCATGTGG - Exonic
1127553473 15:60064661-60064683 GAAGCTTCTAGAGCTCCATGGGG - Intergenic
1127933817 15:63616570-63616592 GAAGCCTCTGGACCTCCACTTGG - Exonic
1128086256 15:64888652-64888674 GGAGACTCTGGGGCTCCCTGAGG - Intronic
1128977651 15:72165277-72165299 GAGGCTTCTGGGCCTCCTAGGGG - Intronic
1129268721 15:74408516-74408538 GAGGCCTCTGGGCTTCTATCTGG + Intergenic
1131307695 15:91259765-91259787 GATGCCTCTGTGTCTCCATATGG + Intronic
1131671643 15:94626145-94626167 GAAGCCTCTGGGTGGCCCTGAGG + Intergenic
1131994973 15:98124885-98124907 GAAGCGTATGGCCCTCCACGTGG + Intergenic
1132086227 15:98910544-98910566 GAGAGCTCTGGGTCTCCATGAGG + Intronic
1132233977 15:100205577-100205599 GAAGCCCCTGAGCCTCTCTGGGG - Intronic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1132612148 16:822544-822566 GGAGCCTCTGGGCCTCCCCCAGG + Intergenic
1132615798 16:840625-840647 AAAGCCTGGGGGCCTCCAGGTGG - Intergenic
1134588695 16:15434695-15434717 GAAGCCTCTGAGGCGCTATGGGG + Exonic
1138523983 16:57591176-57591198 CAAGCCTCTTGGCCTCTCTGAGG + Intronic
1141395324 16:83699420-83699442 GAAGCCTCTGGGCTGCTACGGGG - Intronic
1141649832 16:85386953-85386975 GAAGGTTCTGGGGCTCCCTGGGG + Intergenic
1142121738 16:88389909-88389931 GAAGCACCTGGCCCTGCATGTGG - Intergenic
1142964450 17:3572035-3572057 CCTGCCTCAGGGCCTCCATGAGG - Intronic
1143520529 17:7441789-7441811 GATCCCTGTGGGCCTCCGTGTGG + Exonic
1143724513 17:8836119-8836141 GAAGCCAGAGGGCTTCCATGGGG - Intronic
1144053221 17:11515658-11515680 GTACCCTTTGTGCCTCCATGTGG + Intronic
1144572494 17:16408192-16408214 GTGGCCTCTGGGGCTCCCTGGGG + Intergenic
1144781750 17:17811825-17811847 CAACCCTTAGGGCCTCCATGGGG - Intronic
1144837418 17:18163951-18163973 GAAGCCCCTTGACCCCCATGTGG + Intronic
1146454390 17:32997706-32997728 GATGCCTCCAGGCCTCCCTGAGG - Exonic
1151767257 17:76138907-76138929 GAAGAGTCTGGGCGTCCTTGGGG + Intronic
1152214673 17:79025156-79025178 GGAGCCTCTGAGCCGCCCTGGGG + Intronic
1152400462 17:80063471-80063493 GCAGCCTCAGGGGCACCATGGGG + Intronic
1153248716 18:3098852-3098874 GAACCCTCTATGCCACCATGTGG - Intronic
1155545750 18:26912974-26912996 CCAGCCTCTAGGCCTTCATGGGG - Exonic
1156462021 18:37326521-37326543 AAGGCCACAGGGCCTCCATGGGG - Intronic
1159831028 18:73278624-73278646 GTAGGCTCAGGGTCTCCATGAGG + Intergenic
1161315007 19:3613610-3613632 GGAGCCCCTTCGCCTCCATGCGG - Intronic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1161792460 19:6368569-6368591 CAAACTCCTGGGCCTCCATGGGG - Exonic
1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG + Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1164756626 19:30694785-30694807 GCAGCCACTTGGCCCCCATGGGG + Intronic
1164940599 19:32250248-32250270 TGAGCCACTGGGCCTCCAGGAGG + Intergenic
1165829680 19:38724234-38724256 CGATCCTCTGGGCCTCCTTGTGG - Exonic
1166093750 19:40526908-40526930 GAAGACCCTGAGTCTCCATGAGG - Intronic
1166097452 19:40549814-40549836 GAACCCTCTGGGGCACAATGGGG - Intronic
1166216062 19:41335890-41335912 GAGGCCTCTGGGCTCCCCTGGGG - Intronic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1166746164 19:45142839-45142861 GGGGCCTCTGGGCTTCCATCCGG + Intronic
1167606281 19:50482491-50482513 GAAGCCCCTGGGGCTGCATGGGG - Exonic
1168126295 19:54285446-54285468 GAAGCCTGTGGGATTCCACGTGG - Intergenic
1168175597 19:54625418-54625440 GAAGCCTGTGGGATTCCACGTGG + Intronic
1168717323 19:58537214-58537236 GAAGCCTCAGGTTCTCCATGTGG + Intronic
925595018 2:5547018-5547040 GAAGCCTCAGGGTGGCCATGGGG - Intergenic
926122073 2:10247004-10247026 GAACCCTGTGGGCCTAAATGAGG - Intergenic
928416379 2:31095580-31095602 GAAGCTTTTGACCCTCCATGAGG + Intronic
929258580 2:39839715-39839737 AAAGCCTATGGGAATCCATGTGG + Intergenic
934756544 2:96828326-96828348 GTAGCCCCTGGGCTTCCAGGAGG + Intronic
938383052 2:130847362-130847384 GATGCCTCTGGGTGCCCATGAGG - Intronic
940365401 2:152843465-152843487 GCAGCCTCTGAGCCCCCAGGTGG - Intergenic
942191837 2:173478148-173478170 GAAGGCACTGGGCCTCCCTCCGG + Intergenic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
948061329 2:235044991-235045013 GAAGCCTCCGGGCCCCCATGTGG + Intronic
948524920 2:238565621-238565643 AGAGCATCTGGGCCTCCAGGAGG - Intergenic
948897262 2:240933280-240933302 CGAGCCTCTGGGCCTCCAGCTGG - Intronic
1169478133 20:5950577-5950599 GAAGCCTCTCGGCTTCCGTCTGG + Intergenic
1170591736 20:17776708-17776730 TAAGCCTCTGAGCCACCATGGGG - Intergenic
1172987617 20:39005275-39005297 GTGGTCTCTGGGCCACCATGAGG - Intronic
1174048894 20:47753763-47753785 GGAGCCTCTGGGGCTCCAGCAGG - Intronic
1175263702 20:57690144-57690166 TCAGCCTGGGGGCCTCCATGTGG + Intronic
1175871756 20:62212602-62212624 GGAGCCTCAGGGCCTCCCAGAGG + Intergenic
1175872950 20:62216988-62217010 GTAGCCTGTGGGCCCCTATGTGG + Intronic
1175910872 20:62404960-62404982 GGAGGCTCTGGGCCTGCAGGGGG + Intronic
1176033365 20:63024494-63024516 GGAGCCTCTGGGCCTCCTGTGGG + Intergenic
1177647604 21:23919177-23919199 GAAGCCTCTAAGCCTTGATGGGG + Intergenic
1179884316 21:44306963-44306985 GCAGCCTCTGAGCCTCCAGCCGG - Intronic
1179913228 21:44461043-44461065 GAAGCCTCTGGGCAGGCATCTGG - Exonic
1180159792 21:45993920-45993942 GACGCCTCTGGGGCCCCAGGAGG + Intronic
1180968241 22:19801526-19801548 GAAGCCTCAGGGCCACCTGGCGG - Intronic
1180971270 22:19816977-19816999 GAAGGCCCTGGGTTTCCATGTGG - Intronic
1182706225 22:32282241-32282263 TAAGCCTCAGGGAATCCATGAGG - Intergenic
1183200104 22:36380120-36380142 GCAGCCTCCGGGCCTCCTGGGGG - Intronic
1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG + Intronic
1184382606 22:44155307-44155329 GGGGCCTCTGGGCCTCCGTGGGG + Intronic
1184394539 22:44225306-44225328 TAAGCCTCAGGGAATCCATGGGG - Intergenic
1184757458 22:46525027-46525049 GAAGCCCAGGGGCCTCCAAGAGG + Intronic
1185097955 22:48821925-48821947 GAAGCCCCAGTGCCTCCGTGGGG - Intronic
950429914 3:12944804-12944826 GCAGCCTGTGGGCCACCAAGGGG - Intronic
951540377 3:23776506-23776528 GAAGCACCTTGCCCTCCATGTGG + Intergenic
952347239 3:32499878-32499900 CAAACCTCTGAGGCTCCATGGGG - Intronic
952925362 3:38316024-38316046 GAAGGATCTGAGCCTCCAAGTGG - Intronic
952945069 3:38473544-38473566 GAGGCCCCTGGGTCTCCAGGTGG + Intronic
953350174 3:42209634-42209656 GCAGGGTCTGGGCCTCCAGGTGG - Intronic
953813601 3:46134812-46134834 GAGGCCTCTGGACCTCCCAGAGG - Intergenic
954421288 3:50420356-50420378 GCAGCCTCTGGTTTTCCATGTGG + Intronic
956488415 3:69745674-69745696 GCAGCCTCTCTGCCACCATGAGG - Intronic
957461113 3:80521608-80521630 GAAGCCTGTCTGCCTTCATGTGG - Intergenic
961037514 3:123652894-123652916 GAAGCCACTGGAGCTCCACGGGG + Intronic
961049361 3:123733765-123733787 AATCCCTCTGGCCCTCCATGGGG + Exonic
961567140 3:127771924-127771946 GACTCCTCCTGGCCTCCATGAGG + Intronic
961904714 3:130251097-130251119 GGAACCTCGGGGCCACCATGAGG + Intergenic
963895593 3:150682351-150682373 AGAGCCTCTGGGCCTCTTTGTGG - Intronic
967299294 3:187996831-187996853 CAGGCCTCTGGTCCTGCATGTGG - Intergenic
967441753 3:189517065-189517087 GATGCCTGTGGGAATCCATGTGG - Intergenic
967757939 3:193191141-193191163 GAAGACTCTGGCCCACCATGAGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968622758 4:1611097-1611119 GGGGCCTCTGGGCCACCCTGAGG + Intergenic
968954386 4:3710821-3710843 GAAGGTTCTGGTCCTCCTTGCGG + Intergenic
969108157 4:4823656-4823678 GAAGACTCTGAGGCTCCAGGAGG + Intergenic
969664097 4:8547135-8547157 GGGGCCTCTGAGCTTCCATGAGG + Intergenic
970632192 4:17960283-17960305 CAAGCATCTGGGTCTCCAAGAGG - Intronic
971233152 4:24817214-24817236 GAAGGCTTTGGATCTCCATGTGG + Intronic
974898027 4:67962877-67962899 GAAGACCCAGGGCTTCCATGTGG - Intronic
976112773 4:81693838-81693860 GAAGACTCTGGTCCTAAATGGGG + Intronic
979099579 4:116598655-116598677 CGATCCTCTGGGCCTCCTTGTGG - Intergenic
988096175 5:26613378-26613400 GCTGCCTCTGTGTCTCCATGGGG + Intergenic
988711919 5:33787599-33787621 GCAGCCTCTGTGCCAGCATGTGG - Intronic
990861589 5:60333524-60333546 GAACCTTCTGAGCCTCCACGTGG - Intronic
990952341 5:61310856-61310878 GAAGACTCTGGGCCAACCTGGGG + Intergenic
992215280 5:74519282-74519304 GAAGCCCTTGGGACTCCAGGAGG + Intergenic
994135412 5:96280951-96280973 CAAGCCTGTGGAGCTCCATGTGG + Intergenic
995302775 5:110603419-110603441 GAAACCTCTTGGCCTCCCTTTGG - Intronic
997358589 5:133280191-133280213 GTACCCTCTAGGCCTCAATGTGG + Intronic
998082202 5:139285890-139285912 GAAGCCTATGGGACACCATCAGG + Intronic
999272929 5:150308042-150308064 GAAGCCTCTGGACATCAAAGTGG - Intronic
1002316723 5:178348697-178348719 GGAGCCACTGGGCACCCATGGGG - Intronic
1002895826 6:1379552-1379574 GCAGGCTCTGGGCCGCCCTGTGG - Intergenic
1006220268 6:32484124-32484146 GAAGGCTCTGGGCCTGGAGGCGG - Intergenic
1007871618 6:45046141-45046163 GAAGCAACTGGGTATCCATGTGG - Intronic
1010666603 6:78638112-78638134 AAAGCCTCTTGTCCTCCCTGTGG - Intergenic
1013129466 6:107218335-107218357 GATGCCTCTTGGCCTCTAGGAGG + Intronic
1013177444 6:107689793-107689815 GAGGCCTGGGTGCCTCCATGAGG - Intergenic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1016426673 6:143942473-143942495 GAGGCACCTGGCCCTCCATGCGG - Exonic
1017594807 6:156016957-156016979 GAAGGCACTGGGCTTGCATGTGG + Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1019024096 6:168942797-168942819 GGAGCCTCTGTGCGTCCACGTGG - Intergenic
1019328875 7:452986-453008 GAAGCCCCGGTGCCTCCCTGCGG - Intergenic
1019351240 7:554978-555000 GCAGCCTCTGTGCCCCCATGAGG - Intronic
1019488960 7:1302183-1302205 CACGTCTCTGGGCCTCCACGTGG - Intergenic
1019601167 7:1884492-1884514 ACGGCCTCAGGGCCTCCATGTGG - Intronic
1020467359 7:8495971-8495993 GAACCCTCTGTGCCTTCAGGAGG - Intronic
1021361095 7:19713111-19713133 GAAGCTTCTGAGCCTCTCTGAGG - Intergenic
1022844549 7:34196773-34196795 GAAGCCTATACCCCTCCATGGGG - Intergenic
1024510412 7:50199612-50199634 GAAGCCACTGGGCATGGATGGGG + Intergenic
1025284888 7:57653253-57653275 GCAGCCTCAGGGCTTGCATGGGG - Intergenic
1028064493 7:86365521-86365543 GAAGAATGTGGGCCTCCAGGGGG + Intergenic
1033548073 7:142420726-142420748 GAAGCCACAGTGCCTCCACGTGG - Intergenic
1034127264 7:148684609-148684631 GAGGCCTCTTGCCCTCCAAGAGG - Intergenic
1034197727 7:149261458-149261480 GATGCCTCAGGGCCTAAATGAGG + Intergenic
1034938238 7:155213537-155213559 GGGGCCTCTGGGCCTCCATGAGG - Intergenic
1037584623 8:20268199-20268221 CCTGCCTCTGGGCCTCCAGGAGG + Intronic
1037614781 8:20508892-20508914 GATGCCTCTTGGTATCCATGGGG + Intergenic
1038047034 8:23774185-23774207 GCAGCTTCCGGGTCTCCATGGGG + Intergenic
1038741867 8:30223609-30223631 CAAGCCTCTGAGTCTCCATTAGG + Intergenic
1039223031 8:35356374-35356396 GATGCCTCTGGGCATCCAACTGG + Intronic
1046756717 8:117980096-117980118 GAAGCCTCTGGGTGTTGATGTGG - Intronic
1049145852 8:141000885-141000907 TAAGCCTCTCGGCCTCCGCGAGG + Intronic
1049324425 8:142014651-142014673 GAAGCATCTGGACGTCCCTGCGG - Intergenic
1049422378 8:142522743-142522765 GAAGTCTCTGGGGGGCCATGTGG - Intronic
1049750342 8:144280154-144280176 CAAGCTTCTTGGCCCCCATGGGG - Intronic
1049841242 8:144773964-144773986 GAATCCTCTGGTGCTTCATGAGG + Exonic
1055481516 9:76712957-76712979 GAAGCATCTGGGGCCCCGTGTGG + Intronic
1056103406 9:83322585-83322607 GATGCCTGTGGGATTCCATGTGG + Intronic
1059004194 9:110383737-110383759 GGAGCCCCTGGGGCTCCATGTGG - Intronic
1059382183 9:113935104-113935126 GAAGCCCCTGGGCTGGCATGGGG + Intronic
1061500312 9:130998057-130998079 GAGGCCCCTCAGCCTCCATGGGG - Intergenic
1062013588 9:134280196-134280218 GCAGCCCCTGGGCCTGCAGGAGG - Intergenic
1062027375 9:134346800-134346822 CAAGCCCCTGGGCCTCCAGGAGG - Intronic
1062211437 9:135366364-135366386 GAGGCCTCTGGCCCCCCAAGAGG - Intergenic
1062376054 9:136262358-136262380 GGAGCTGCTGGGCCTGCATGGGG + Intergenic
1062475068 9:136722663-136722685 GAAGCCTCAGAGCTTCCCTGAGG - Intronic
1186006399 X:5077028-5077050 TAAGCTTCTGGACCTCCGTGGGG + Intergenic
1192317257 X:70062671-70062693 GAGCCATCTCGGCCTCCATGCGG - Exonic
1194114082 X:89874028-89874050 AAAGCCTGTGGGATTCCATGTGG + Intergenic
1195502166 X:105613877-105613899 GACACCTCTGGGCATGCATGGGG + Intronic
1195697362 X:107676884-107676906 AAGGCATGTGGGCCTCCATGCGG - Intergenic
1197094284 X:122574768-122574790 GATGCCTGTTGGCCACCATGAGG - Intergenic
1198406621 X:136319208-136319230 GCAGCCTCTGGGCCTCCAGCAGG - Intronic
1199327125 X:146512810-146512832 TAGGCCTCTGGGCCTCCACTGGG - Intergenic
1200054189 X:153450188-153450210 GCAGCCTCTGAGGGTCCATGGGG - Intronic
1200164030 X:154023884-154023906 GCAGCCTCTGGGCCCACATCCGG - Intronic
1200466822 Y:3529384-3529406 AAAGCCTGTGGGATTCCATGTGG + Intergenic