ID: 1075922207

View in Genome Browser
Species Human (GRCh38)
Location 10:126223316-126223338
Sequence AGGGAGCAGAAGAATGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 1, 2: 0, 3: 26, 4: 331}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075922207_1075922214 29 Left 1075922207 10:126223316-126223338 CCTGTCACATTCTTCTGCTCCCT 0: 1
1: 1
2: 0
3: 26
4: 331
Right 1075922214 10:126223368-126223390 AGATGAACACTATTTGTGGATGG No data
1075922207_1075922211 6 Left 1075922207 10:126223316-126223338 CCTGTCACATTCTTCTGCTCCCT 0: 1
1: 1
2: 0
3: 26
4: 331
Right 1075922211 10:126223345-126223367 AGCTGAGGTTCTAAGCACCAAGG No data
1075922207_1075922215 30 Left 1075922207 10:126223316-126223338 CCTGTCACATTCTTCTGCTCCCT 0: 1
1: 1
2: 0
3: 26
4: 331
Right 1075922215 10:126223369-126223391 GATGAACACTATTTGTGGATGGG No data
1075922207_1075922213 25 Left 1075922207 10:126223316-126223338 CCTGTCACATTCTTCTGCTCCCT 0: 1
1: 1
2: 0
3: 26
4: 331
Right 1075922213 10:126223364-126223386 AAGGAGATGAACACTATTTGTGG No data
1075922207_1075922208 -9 Left 1075922207 10:126223316-126223338 CCTGTCACATTCTTCTGCTCCCT 0: 1
1: 1
2: 0
3: 26
4: 331
Right 1075922208 10:126223330-126223352 CTGCTCCCTCAAATCAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075922207 Original CRISPR AGGGAGCAGAAGAATGTGAC AGG (reversed) Intronic
900957522 1:5896027-5896049 AGGGAGCAGAAGAGTGTATTTGG + Intronic
901082549 1:6591739-6591761 AGGGAGCAGAGGAAGGAGAAGGG + Exonic
902215133 1:14930023-14930045 CGGAACCAGAAGAGTGTGACAGG + Intronic
902292471 1:15444514-15444536 AGGGAGCAGATGCCTGGGACAGG - Intronic
902544606 1:17182093-17182115 GGGGAGGAGGGGAATGTGACAGG - Intergenic
903673223 1:25048497-25048519 AGAGAGGAGAAGAAGGTGAAGGG - Intergenic
903781917 1:25826163-25826185 AGGGGGCAGAAGAAGGTTCCTGG - Intronic
904599269 1:31664842-31664864 ATGGAGGAGTAGAATGTGATAGG - Intronic
905696783 1:39980535-39980557 AGAGAGGAGAAGAAAGTGACAGG + Intergenic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
906879253 1:49572909-49572931 AGTGGGCAGAAAAATGTGAAAGG + Intronic
907776704 1:57522811-57522833 AGCAGGCAGAAGAATGTGAAAGG + Intronic
909087820 1:71188318-71188340 TGGGGGAAGAAGAATATGACGGG - Intergenic
909561957 1:77017037-77017059 AGGGGGCAGGGGAATGAGACTGG + Intronic
909882050 1:80891982-80892004 AGGGAGTAAAAGAATGTTCCTGG + Intergenic
910390078 1:86732789-86732811 AGGTAGCAGATTAAGGTGACCGG - Intronic
910793269 1:91072989-91073011 AAGAAGAAGAAGAATGTGACTGG + Intergenic
910964228 1:92791938-92791960 ATGGAGAAGAAGAAAATGACTGG - Intronic
912281242 1:108316680-108316702 AGGGAGCAGAAGTATGAAATGGG - Intergenic
913564204 1:120055631-120055653 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
913633920 1:120737934-120737956 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
914233666 1:145788732-145788754 AGAGGGCAGAAGAATGGGAGAGG - Intronic
914284792 1:146214979-146215001 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914545823 1:148665718-148665740 AGGGAGCAGAAGGGAGTGGCAGG + Intronic
914620740 1:149404948-149404970 AGGGAGCAGAAGGGAGTGGCAGG - Intergenic
915147090 1:153801690-153801712 CGGGAGCAGGGGAATGTGAAGGG - Intergenic
917238816 1:172924085-172924107 AGGGAACTTAATAATGTGACAGG - Intergenic
918183898 1:182110557-182110579 AAGGAAGAGAAGCATGTGACAGG + Intergenic
918562274 1:185883400-185883422 AGGGAGCAGAAGTGAGTGAAAGG - Intronic
918782297 1:188716376-188716398 AGTAAGCAGAAAAATGTGATTGG + Intergenic
920451315 1:206063219-206063241 AGCGAGGAGATGAATGTGTCTGG + Intronic
920660136 1:207908562-207908584 AGGAAGAAGAGGAATGTGACGGG + Intronic
920856633 1:209668088-209668110 AAGGAACAGAACAGTGTGACTGG + Intergenic
921442385 1:215202983-215203005 AGGGAGGAGAAGAATGGGGGAGG - Intronic
921525740 1:216215501-216215523 GGGGAGCAGAAAAATGTAAATGG - Intronic
921643359 1:217582697-217582719 AAAGACCAGAAGAAGGTGACAGG + Intronic
922076624 1:222251555-222251577 AGTGCGCAGAAGCATGTGCCTGG + Intergenic
922593909 1:226799086-226799108 AGGAAGCAGAGGAGTGTGACGGG + Intergenic
922685910 1:227638792-227638814 AGGGAGCAGAAGAGTGGAGCAGG + Intronic
1064834998 10:19516759-19516781 AGGGAGGAGAAGAAGGTGAAGGG - Intronic
1065070752 10:22021628-22021650 AGGGAGCACAGGAATGAGAGGGG + Intergenic
1065318506 10:24487115-24487137 AGGGAGAAGAAGAAGGAGAAGGG - Intronic
1066640295 10:37548593-37548615 AGGGAACAGAAGTGTCTGACTGG + Intergenic
1067186179 10:44029877-44029899 AGGGAGGAGAAGACTGGGATGGG + Intergenic
1067794017 10:49307811-49307833 AGAGAGGAGGAGAATGGGACTGG - Intronic
1069095757 10:64257964-64257986 AGGAAGCAAAAGAATTAGACAGG + Intergenic
1069824484 10:71246720-71246742 TGGGATCAAAAGAATGTGGCTGG - Intronic
1071054132 10:81489357-81489379 AAGGAGCAGCAGAATTTGAGGGG + Intergenic
1071670960 10:87609198-87609220 GGGGAGCAGATGAGTGTGGCAGG - Intergenic
1073616447 10:105001251-105001273 AGAGAGAAGAAGAATGTTTCTGG + Intronic
1073767725 10:106701616-106701638 AGGGACCAAAAAAATGTCACAGG - Intronic
1075455645 10:122583172-122583194 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075457768 10:122595875-122595897 AGGGAGAAGAGGAAAGTGCCAGG + Intronic
1075747167 10:124736079-124736101 AGGTAGGAGATGAGTGTGACTGG - Intronic
1075922207 10:126223316-126223338 AGGGAGCAGAAGAATGTGACAGG - Intronic
1076555583 10:131319211-131319233 AGGCACCAGAAGAATGAGAGTGG + Intergenic
1076624914 10:131815875-131815897 AGGCAGCAGCAGGATGTCACAGG + Intergenic
1076910992 10:133389451-133389473 AGTGAGCAGCAGAGTGTGTCAGG - Intronic
1077008757 11:370800-370822 AGGGGGCAGAACAATGATACTGG + Intronic
1077245942 11:1538325-1538347 AGGAAGCAGGAGACTGGGACAGG - Intergenic
1078605801 11:12774478-12774500 AGAGAGCAGAACAGTGGGACAGG + Intronic
1081943962 11:46972056-46972078 ACTGAGCAGAAGAATTTGAATGG - Intronic
1082852333 11:57776454-57776476 GCGAGGCAGAAGAATGTGACTGG - Intronic
1083196597 11:61092127-61092149 AGGAGGCTGAGGAATGTGACTGG - Intergenic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1084135446 11:67176273-67176295 AGGGAGTAGAAGTCTGTGAAAGG - Intronic
1085338665 11:75717370-75717392 AGTGAGCAGAAAAATGGGGCAGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086435048 11:86771845-86771867 AGGGAACAGCAGAGTGTGATGGG + Intergenic
1086638169 11:89117363-89117385 AAGGAACAGAAGAAAGTCACTGG + Intergenic
1087155850 11:94902366-94902388 AGCTAGCAGAAGAATGAAACTGG - Intergenic
1088005858 11:104939121-104939143 ATGGGGCAGAGGAAAGTGACTGG + Intergenic
1088360550 11:108984766-108984788 ATGGAGCAGAAGCATGGGCCTGG + Intergenic
1088803640 11:113330888-113330910 AGGTACCAGGAGAATGTGCCAGG + Intronic
1089644145 11:119866874-119866896 AGAGAGCAGATGAAAGTTACTGG + Intergenic
1089657400 11:119960523-119960545 AGGCAGCAGGAGAAGGTGACAGG + Intergenic
1089693432 11:120200835-120200857 AGGGAGCAGAACAAAGGTACAGG + Intergenic
1092191528 12:6524859-6524881 AGTGAGGAGAAAAATGTGGCTGG - Intronic
1094574347 12:31670236-31670258 AGGGAGCAGAAGCCTGTTGCTGG - Exonic
1095755700 12:45764487-45764509 AAGGGACAGAAGAATGTGAGGGG - Intronic
1096264221 12:50110851-50110873 TGGCAGCAGAGGAATGTCACAGG + Exonic
1097279986 12:57839143-57839165 GGGGAGCAGCAGAATGTCCCTGG - Intronic
1097561951 12:61218611-61218633 AGGCAGGAGAAGAGTGGGACAGG - Intergenic
1098309776 12:69136888-69136910 AGATAGCAGAAGAATGAGATAGG - Intergenic
1098957379 12:76701789-76701811 AGGCACCAGAAAGATGTGACTGG - Intergenic
1100379549 12:94048869-94048891 ATGGAGCAGAGGAAGGTGAGAGG - Intergenic
1101008890 12:100429942-100429964 AGAGAGCAGAAGAAAGAGAAGGG - Intergenic
1101014451 12:100485115-100485137 ATAGAGCTGCAGAATGTGACTGG - Intronic
1101543443 12:105685837-105685859 AGGGAATAGAAGATTGTGGCAGG - Intergenic
1101892553 12:108730707-108730729 AGGGAGCAGAGGGCTGGGACTGG - Intronic
1102397979 12:112603787-112603809 AGGGCGAAGAAAAATGAGACTGG - Intronic
1102977497 12:117217097-117217119 AGGCACCAGAAGACTGTGCCCGG - Intronic
1105439016 13:20400450-20400472 ATGGAGCAGGAGAGAGTGACAGG - Intergenic
1106192955 13:27470133-27470155 TGGGATTAGAAGAATGTTACCGG + Intergenic
1106674297 13:31941500-31941522 AGGGAGCAGAGAATTGTAACGGG + Intergenic
1106785676 13:33106099-33106121 AGGGAGCAGCAAAAGGGGACAGG + Intronic
1106792254 13:33167594-33167616 AGGCAAAAGAAGCATGTGACTGG - Exonic
1107225488 13:38044097-38044119 AGAAAACAGAAGAATGAGACAGG + Intergenic
1107458006 13:40572898-40572920 AGGGAGCAGCAGTTTGTGAGGGG - Intronic
1108389920 13:49937107-49937129 AGGGTTCCGAGGAATGTGACGGG + Intergenic
1108615177 13:52125812-52125834 AGTGAGCAGAATAATGTCATGGG + Intronic
1109384491 13:61608924-61608946 AGGGATCAGAAGAAAGTGGAAGG - Intergenic
1110436982 13:75486250-75486272 AGGAAGCAGAAGAAGGGGAGAGG + Intergenic
1112109179 13:96275826-96275848 AGAGAGAAGAAGAATGGTACTGG - Intronic
1112528442 13:100176058-100176080 AGGGATCAGATGATTGTGATTGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113362837 13:109647077-109647099 AGGGGGCCCAGGAATGTGACTGG - Intergenic
1115450198 14:33539106-33539128 AGGGAGAAGAAGATTGTGTAGGG + Intronic
1116083904 14:40209762-40209784 AGGGAGAAGAACAATGATACAGG + Intergenic
1116181079 14:41536648-41536670 ATGAAGCAGAAGAATGAAACTGG - Intergenic
1116902738 14:50377429-50377451 AGAGAGCAGGAGTAGGTGACAGG - Intronic
1119646887 14:76354613-76354635 AGGGACCAGAATAAGGTGAGGGG + Intronic
1119921926 14:78454763-78454785 AGGGAAGAGAAGAGTGTGTCTGG + Intronic
1119987990 14:79161820-79161842 AGGGTGCAAAGGAAAGTGACTGG + Intronic
1120699955 14:87688254-87688276 AGGAGGGAGAAGAATGTGATAGG - Intergenic
1121174805 14:91882998-91883020 CAGGAGCAGAAGTATGTGCCGGG + Exonic
1122190412 14:100038142-100038164 AGGCAGCAGAAGGAAGTGCCTGG + Intronic
1122559868 14:102605206-102605228 AGGAAGAAGAGGAATGTAACTGG - Intronic
1124836642 15:33201846-33201868 AGAGAGGAGAAGAATGTGAGGGG + Intergenic
1125499188 15:40227790-40227812 ATGGAGCAGAGGAATGGTACAGG - Intergenic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125792703 15:42381254-42381276 AGGGAGAAGAAAAATGATACAGG - Intronic
1127387670 15:58480113-58480135 AGGAAGAAGATGAATGTTACTGG - Intronic
1127773079 15:62245936-62245958 AAGGAGCTGGAGAATCTGACAGG - Intergenic
1129804761 15:78446542-78446564 AGGAAGCAGAAGAGTGGAACAGG - Intronic
1130679956 15:85988021-85988043 AGGGAGGAGAGGATTGTGAGTGG + Intergenic
1132108840 15:99087482-99087504 AGGGAGCAGCAGAATGTTTCCGG - Intergenic
1132831886 16:1932468-1932490 AGGGAGAAGCAGAAAGGGACAGG + Intergenic
1133579984 16:7135163-7135185 AGGAAACAGAACAATGTAACAGG - Intronic
1134433971 16:14237903-14237925 AAGGACCAGAAAAATGTAACAGG + Intronic
1135182150 16:20284811-20284833 AGAGAGTAGAAGGATGTAACCGG + Intergenic
1135965523 16:27031960-27031982 GGGAAGCAGAAGAGTGTGACTGG - Intergenic
1137731935 16:50695926-50695948 AGGGAGCAGATAAATGGGATTGG + Intronic
1138301770 16:55936401-55936423 TGGGAGGAGAAGTATCTGACTGG - Intronic
1138340153 16:56283878-56283900 ATGGAGCAGCAGAATGAGATGGG - Intronic
1138488284 16:57360649-57360671 AGGGATGAGAGGAATGTGGCAGG + Intronic
1140644257 16:77012309-77012331 AAGGAGTAACAGAATGTGACAGG - Intergenic
1143105497 17:4528399-4528421 AGGGAGCAAAAGCAAGTTACAGG + Intronic
1143333681 17:6157076-6157098 AGGGAGCAGAAGTGAGGGACGGG + Intergenic
1143904894 17:10200031-10200053 AGGGAGCCACAGAAGGTGACTGG - Intergenic
1144077529 17:11732825-11732847 AGGGAAGAGAAGAAAGTGCCAGG - Intronic
1144389802 17:14783426-14783448 ATGGAGCAGGAGAAGGTCACAGG + Intergenic
1145277288 17:21439624-21439646 ATAGAGCAGAAGAATCTTACAGG + Intergenic
1145315124 17:21725518-21725540 ATAGAGCAGAAGAATCTTACAGG + Intergenic
1145713558 17:26997455-26997477 ATAGAGCAGAAGAATTTTACAGG + Intergenic
1145942429 17:28749660-28749682 AGGCAGCAGAAGCAGCTGACGGG - Exonic
1146296285 17:31653187-31653209 AGAGAGGAGAAGAAGGTGCCAGG + Intergenic
1146920752 17:36708994-36709016 GGGGAGGAGGAGAGTGTGACTGG - Intergenic
1146953503 17:36922503-36922525 AGGGAGCAGCTGTATGTGCCAGG - Intergenic
1147400287 17:40176932-40176954 AGGGAGCAGCAGGTTGTGGCAGG - Intergenic
1147457355 17:40546093-40546115 GGGCAGCAGAACAATGTGAAGGG - Intergenic
1147998881 17:44376136-44376158 TGGCAGCAGAAGAAGGTGAGAGG - Exonic
1148772073 17:50073082-50073104 AGGGAGCAGAAGCAGGTCCCAGG - Intronic
1149999686 17:61425953-61425975 AGGGAGAGGAAGGATGGGACAGG + Intergenic
1151659225 17:75509875-75509897 GAGGAGCAGGACAATGTGACAGG + Intronic
1154261935 18:12842633-12842655 AGGGACATGAAGAATGTGGCTGG + Intronic
1155185502 18:23383529-23383551 CAGGAGCAGCAGAAGGTGACAGG + Intronic
1155406486 18:25493760-25493782 AGAGAGGAGAAGAAAGTGCCTGG + Intergenic
1156317401 18:35983299-35983321 AGGATGCATAAGCATGTGACAGG - Intergenic
1157622851 18:49026195-49026217 AGGGAGCAGAAGAAACTGCCTGG - Intergenic
1157891808 18:51425348-51425370 GGGGAAGAGAAGAATGTGATGGG + Intergenic
1158031694 18:52973474-52973496 AGGGAGCAGAAATATGAGAAAGG - Intronic
1158547537 18:58408908-58408930 AGGGAGCAAAACCATGTGAAAGG - Intergenic
1160213379 18:76903360-76903382 AGGGACCAGAAGACTGTTCCAGG + Intronic
1162691457 19:12436711-12436733 AGAGAGAAGAAAAATGTTACAGG + Intronic
1162732045 19:12724122-12724144 GGGGAGCAGAAGAGTGAGACTGG + Intergenic
1162991757 19:14307416-14307438 GGGGAGAAGAAAAATGAGACAGG - Intergenic
1163126047 19:15244702-15244724 AGGGAGCAGAAGAAGGTACATGG - Exonic
1163312364 19:16522055-16522077 ACGGAGCAGAAGAAGGATACAGG - Intronic
1164692444 19:30221626-30221648 AAGGAGCAGAAGAGAGTGAAGGG + Intergenic
1165856815 19:38883878-38883900 AGGGAGGAGAAGCAAGTGGCAGG + Intronic
1166102688 19:40580528-40580550 AGGGATCAGAAGAGGGTCACAGG - Intronic
1166333347 19:42091219-42091241 AGGGACCAGAGGAATGGGAGGGG + Exonic
1168492436 19:56821961-56821983 TGGGAGCAGAAGGATGAGGCAGG - Intronic
1202715540 1_KI270714v1_random:40330-40352 AGTGACCAGAAGCCTGTGACGGG + Intergenic
925317340 2:2936459-2936481 AGGGAGGAAAGGAATGTGAGAGG - Intergenic
926297536 2:11579500-11579522 AGTTAGCAGAAGAAAGTGCCTGG - Intronic
927418761 2:22907359-22907381 AAGAAGCAGAAAAATGTGTCAGG - Intergenic
928098050 2:28417536-28417558 AGGGAAAAGAAGAATGAGACGGG - Intergenic
929430150 2:41879713-41879735 AGGCTGCAGCAGAAAGTGACAGG - Intergenic
929509574 2:42556196-42556218 GAGAAGCAGAAGAATGAGACTGG - Intronic
930468742 2:51787076-51787098 AGGGAACAGAAGGAGGTTACAGG - Intergenic
932558951 2:72850634-72850656 AGGGAGCAGCAGAGCGGGACAGG - Intergenic
932583138 2:73005586-73005608 TGGGAGGAGAAGAATGGCACTGG - Intronic
932850365 2:75178617-75178639 AGCTAACAGAAGAATGTGAGGGG - Intronic
935926071 2:108070288-108070310 AGGGAGCAGCAGAAAGGGACAGG - Intergenic
937793028 2:125982398-125982420 AGGGCACAGAAGAATGTCAAAGG - Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938781896 2:134592052-134592074 AGGGAGAAGGAGAGTGTTACAGG + Intronic
939142167 2:138367927-138367949 AGAGAGCAAAAGAAGGTGTCTGG - Intergenic
939268462 2:139907165-139907187 AGAGAGCAGAAGAGAGCGACTGG + Intergenic
939648266 2:144729210-144729232 AGGTAACAGAAGAAGATGACAGG - Intergenic
944066405 2:195624052-195624074 AGGGATCACAAGATTTTGACTGG - Intronic
945140418 2:206680492-206680514 AAGTAGCAGAATAATGTGTCTGG - Intronic
945470370 2:210222310-210222332 AGGGATCAGGAGTATGTGCCTGG + Intronic
945520720 2:210824041-210824063 AGGGAGGAAAAGAGGGTGACAGG - Intergenic
945981237 2:216313076-216313098 AAGGTGCAGAAGAATGAAACTGG - Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
1168952879 20:1814603-1814625 AGGCAGCAGAAGAGTGTTCCTGG - Intergenic
1169044995 20:2528097-2528119 ATGGAGCAGAAGAAAGGGGCAGG + Intergenic
1169920216 20:10726978-10727000 AGTGAGCAGCAGAATGGGACTGG + Intergenic
1170100883 20:12698108-12698130 AGGAAGCTGAAGAATGTTTCAGG - Intergenic
1171234318 20:23511935-23511957 AGTGACCACAAAAATGTGACTGG + Intergenic
1171259420 20:23718482-23718504 AGGAAACAGAAGAAGGGGACTGG + Intergenic
1171479516 20:25443060-25443082 AGGGAGCAAAAGAATGTTTCAGG + Intronic
1172994580 20:39060604-39060626 AGGGAGCAGAATAATGTGTGTGG + Intergenic
1173136851 20:40446425-40446447 CTGGAGCAGAAGACTGGGACTGG + Intergenic
1173384603 20:42575835-42575857 AGGCAACAGAAGATTGTGGCTGG - Intronic
1173571744 20:44081597-44081619 AGTGGGCAGAAGGCTGTGACTGG - Intergenic
1173904938 20:46619718-46619740 AAGAAGCAGAAGAATGTTCCTGG - Intronic
1175514912 20:59563219-59563241 AGAAAGCAGATGAATGAGACAGG + Intergenic
1176228319 20:64016721-64016743 AGGATGCCGAGGAATGTGACAGG + Exonic
1177415053 21:20782194-20782216 AGGGTGGAGAATAATGAGACAGG - Intergenic
1177486454 21:21762882-21762904 AGTAAGAAGAAGAATGTGACTGG - Intergenic
1177642001 21:23855546-23855568 TGGGAGCAAAAGACTTTGACAGG + Intergenic
1177734364 21:25070473-25070495 GGGCAGAAGTAGAATGTGACAGG - Intergenic
1177965416 21:27720582-27720604 AGAGAGGAGAAGAAGGTGCCAGG - Intergenic
1178275736 21:31235126-31235148 TGGGAGCAGGACAATGTGCCAGG + Intronic
1178551480 21:33543177-33543199 TGGGAGCAGAAGAATCTGGGAGG - Intronic
1178716522 21:34969286-34969308 AGGGAGCAGGTGGAGGTGACTGG + Intronic
1179666706 21:42917815-42917837 AGGGAGCCAAAGATTGTGAGAGG - Intergenic
1181179270 22:21055605-21055627 AGGGAGCAGAAGACAGACACAGG + Intronic
1181572234 22:23773834-23773856 AGGGAGCAGGAGGGTGTGACAGG + Intronic
1182341077 22:29621306-29621328 AGGGAACAGAGGCATGTGAGGGG - Intronic
1182413419 22:30205710-30205732 AGGGAGGAGAGGAATTTGGCAGG + Intergenic
1184032676 22:41904198-41904220 AGGGAGCAGCAGAATGGAAATGG - Intronic
1184125211 22:42481957-42481979 AGGGGGGAGAAGAATGAGAGAGG - Intergenic
1184277024 22:43414773-43414795 AGGGAGAAGAAGAATGGAAAGGG - Intronic
1184543864 22:45152036-45152058 AGGGCTCAGAAGAATGATACCGG + Intergenic
1185208227 22:49552429-49552451 ATGGATCAAAAGAAAGTGACAGG + Intronic
1185419161 22:50725825-50725847 AGGGAGGAGAAGGATGGGCCTGG - Intergenic
949495748 3:4630223-4630245 AGGCAGCTGTAGACTGTGACTGG + Intronic
950080355 3:10217614-10217636 AGGGAGCAGAACTAGGTGATTGG + Intronic
951665776 3:25121896-25121918 AGAAAGTAGAAGAACGTGACAGG - Intergenic
951875460 3:27419891-27419913 AGAGGACAGAAAAATGTGACAGG + Intronic
952919958 3:38277345-38277367 AGGGAGCAGAAGGCTGTCATTGG - Intronic
953917536 3:46930303-46930325 AGGCAGCAGAAGACTGTGGCAGG + Intronic
954211843 3:49102165-49102187 AGGGAGCTGAATGCTGTGACAGG + Intronic
954361959 3:50126788-50126810 TGGGAGCAGAAGACTGAGGCAGG + Intergenic
954788001 3:53109088-53109110 AGGGTGCAGCAGAAGATGACAGG - Intronic
955947699 3:64210921-64210943 AGGGAACAGAAGAATGAAAGTGG + Intronic
959626901 3:108463003-108463025 AGGGAGCAGAAACATATCACAGG + Intronic
960158721 3:114325680-114325702 AGGGAACAGGACAATGTGATGGG - Intergenic
963188744 3:142446188-142446210 AGGGAGAAGAAGTAAGTTACGGG - Intronic
963923687 3:150929325-150929347 AGGGAGCAGAAGCAGGTGGCAGG + Intronic
966631849 3:182084869-182084891 AAGGAAGAGAAGCATGTGACTGG + Intergenic
967266116 3:187693741-187693763 AGGGAACAGCAGAATTTGAAGGG + Intergenic
969637905 4:8379986-8380008 AGGGAGCAGTGGAAGCTGACAGG + Intronic
971261743 4:25063488-25063510 ATGGAGCAGAAGAATGGTAGAGG + Intergenic
972705490 4:41538776-41538798 AGTCAGGAGCAGAATGTGACAGG - Intronic
973276947 4:48319952-48319974 AGGGAGTAGGAGAAGGTGAGAGG + Intergenic
974124582 4:57680162-57680184 AGGGACCAGATGCATGTGAAAGG - Intergenic
975587603 4:75965973-75965995 AGGGACCTGAAGAAAGTGAGGGG - Intronic
976346020 4:84002483-84002505 AGGGAACAAAAGAATGTGTAGGG - Intergenic
977453602 4:97228965-97228987 AGGGAGCAGAGAAATGAAACAGG + Intronic
977556552 4:98492627-98492649 AGGGAGCAAAGGGATGTGCCAGG + Intronic
979555922 4:122047505-122047527 AAGGAGCAAGAGAATGAGACAGG + Intergenic
979831883 4:125314907-125314929 AGGGAGGGGCAGAAGGTGACAGG + Intergenic
980365568 4:131800080-131800102 AGAGAGTAGAAAAATGTTACTGG + Intergenic
981775283 4:148360017-148360039 AGGTAGCAGAACAAAGTGAAAGG + Intronic
982275014 4:153629599-153629621 AGGGAGGAGAGGAATTTGAATGG - Intronic
982475895 4:155850122-155850144 AGGGAGCAGGGGAATGGGAAAGG + Intronic
983874929 4:172864262-172864284 AAGGAGCAGATGAATGGGAAAGG - Intronic
984794547 4:183646310-183646332 AGGGAAAAGAAGAATGTAAAAGG + Intronic
986688900 5:10297739-10297761 AGGGAACTGGAGAGTGTGACAGG + Intronic
987165510 5:15194134-15194156 AGGGAGCACCAGCATGTGATGGG + Intergenic
989272589 5:39550485-39550507 AGGGAGTAGCAGAAAGTGTCAGG + Intergenic
992366497 5:76096581-76096603 AGGTGGCAGAAGTATGTGAAAGG + Intronic
995179649 5:109219143-109219165 AGGAAGCAGAAGACTGGGGCTGG - Intergenic
995254211 5:110028105-110028127 ATGGAGGTCAAGAATGTGACAGG - Intergenic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
995344707 5:111098536-111098558 AGGGAGCAGATGAACATGCCTGG + Intronic
997361410 5:133297636-133297658 AGGGAGCAGGAGGCTGTGGCTGG - Intronic
997411259 5:133692739-133692761 AGGGAGCAGCAGGAAGTGAGAGG - Intergenic
998256399 5:140591899-140591921 AGTGAGCAGTAGAGTGAGACTGG + Intronic
998882079 5:146654810-146654832 TGGGAGCAGAAGTCTGGGACAGG - Intronic
999057682 5:148597488-148597510 AGTAAGAAGAAGAATGAGACAGG - Intronic
1000775933 5:165419773-165419795 AGGATGCAGAAGAATATGACTGG - Intergenic
1001557075 5:172643916-172643938 GGAGGGCAGAAGAATGTGCCGGG - Intronic
1002104578 5:176873829-176873851 AGGGAGCAGACGCTTGTGGCAGG - Intronic
1002583737 5:180227883-180227905 AGAGACCAGAGGAATGTGAGAGG - Intergenic
1003631860 6:7794620-7794642 AAGGAGAAGAAGAATGTAAAGGG + Intronic
1007454334 6:41964731-41964753 AGGGAGCAGAGGGCTGTTACAGG + Intronic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1009765667 6:68071684-68071706 AGGGAAGAGAAGATTATGACAGG + Intergenic
1013049091 6:106514215-106514237 AGGGAGCAGAAGTGTGAGAAGGG - Intronic
1013141505 6:107340735-107340757 AGGGAACAGAAGTAGGAGACGGG + Intronic
1014366361 6:120547618-120547640 AGGAAGTAGTAGAATGAGACAGG - Intergenic
1015169220 6:130232415-130232437 AAGGAGCAGAAAAATGAAACAGG - Intronic
1015670590 6:135685507-135685529 AGGGAGAATAAGAATGTCACAGG + Intergenic
1016100889 6:140098758-140098780 AGGGAGCAGGAGAATGTGACGGG + Intergenic
1016672258 6:146722480-146722502 AGAGAGCAGCTGAATGTGATTGG + Intronic
1018432120 6:163730672-163730694 AGGTGACAGAGGAATGTGACAGG - Intergenic
1018630408 6:165817161-165817183 TGGGAGAAGAAAGATGTGACAGG - Intronic
1021919871 7:25474067-25474089 AGGGAACAGAAGAATGGGGCTGG + Intergenic
1022500058 7:30877126-30877148 AGGGAGCCCAGGAATGTGGCTGG + Intronic
1022567641 7:31419289-31419311 AGGGATCACAGGAATGTGTCTGG - Intergenic
1023854676 7:44175475-44175497 TGGGAGCAGGAGAATGAGAGGGG + Intronic
1024049278 7:45608691-45608713 AAGGACCACAAAAATGTGACAGG - Intronic
1025016181 7:55440686-55440708 AGGGAGCACAAGCGTGTGCCTGG + Intronic
1026124789 7:67570137-67570159 AGGTAACAGGAGAATGTGAGGGG + Intergenic
1027146689 7:75700455-75700477 AGAAAGCAGAAGAAGATGACAGG + Intronic
1027618024 7:80448268-80448290 AGGGAGAAGAAGAATGTTCTGGG + Intronic
1030351877 7:108498574-108498596 AGGGAGCTTAAAAATCTGACTGG - Intronic
1030800775 7:113848599-113848621 AGTGAGCTGAAGAATTTGCCAGG - Intergenic
1031133737 7:117862590-117862612 AGGGAGGAGCAGAGTGTGCCTGG - Intronic
1034427226 7:151020377-151020399 AGGGAGGAGGAGAACGAGACGGG + Intronic
1034633651 7:152550398-152550420 TTGAAGCAGAAGAATGTGAGAGG + Intergenic
1035559449 8:593739-593761 CGTGAGCAGAAGGATGTGAGGGG + Intergenic
1038553591 8:28490574-28490596 AGTGACCAGGACAATGTGACTGG - Intergenic
1039039262 8:33391855-33391877 AGGTAGCAGCAGACAGTGACTGG - Intronic
1039042427 8:33420614-33420636 GGGGAGCAGAAAAATGTATCTGG + Intronic
1040550091 8:48430920-48430942 AGGGAGCAGAGGAAGGAGATAGG + Intergenic
1041545812 8:59040991-59041013 TGGGAGCACAGGATTGTGACAGG - Intronic
1045266554 8:100623489-100623511 AGGGAGGAGGAGAGTGTGGCTGG - Intronic
1046379142 8:113431288-113431310 AGGGAACAGAAGAAAGAGATAGG + Intronic
1046392709 8:113597533-113597555 AGGAGGCAGAAGCATGTGATGGG + Intergenic
1046589099 8:116184108-116184130 AGGGCACAGAAGAATGTGAGAGG + Intergenic
1046823774 8:118664318-118664340 CAGGTGCAGAAGAATGAGACAGG + Intergenic
1047101342 8:121679461-121679483 AGGGATTAGGAGAATGGGACAGG + Intergenic
1048563670 8:135570661-135570683 AGGAAGGAGAAGAGGGTGACTGG - Intronic
1048763499 8:137822495-137822517 AGGAACCAAAAGAATGTGGCAGG + Intergenic
1049262660 8:141648004-141648026 AGGGAGCAAAATAAAGAGACAGG - Intergenic
1050058517 9:1680427-1680449 AGGGAGGAGAAGAATGTCTGAGG + Intergenic
1051316824 9:15844964-15844986 ATTGAGCAGAAGAATTTGAATGG + Intronic
1052998371 9:34563957-34563979 AGGGAGCTGAAGGAAGGGACGGG - Intronic
1055573373 9:77639565-77639587 AGGGTGCAGAAGATGGTCACAGG + Intronic
1056742432 9:89269523-89269545 CACGAGCAGAAGAATGTAACTGG - Intergenic
1057163904 9:92911657-92911679 AAGGTGCAGAAGAATGTGTAAGG + Intergenic
1057918532 9:99076440-99076462 AGAGAGCAGAGAAATGAGACAGG + Intergenic
1057977058 9:99616921-99616943 AGGGAGCAGAAGGATGCAGCAGG + Intergenic
1058639069 9:107065535-107065557 TGGGATCAGAAGATAGTGACTGG - Intergenic
1058963134 9:110010343-110010365 AGGGAGAAGAGGAATGTAAGAGG + Intronic
1059130167 9:111739487-111739509 AGGAAGCAGAACAGTGGGACAGG - Intronic
1059258478 9:112953026-112953048 AGGAAGAAGAAAAATGTCACCGG - Intergenic
1060146134 9:121253929-121253951 AAGGAGAAGAAGAAAGTGAAGGG - Intronic
1060538694 9:124414556-124414578 AGGAAGCTGAAGTATGTGATGGG - Intronic
1061205762 9:129162363-129162385 AGGGACCAGGAGAAGGTGGCAGG + Intergenic
1061458821 9:130719580-130719602 AGGGATCTGAAAAAAGTGACAGG - Intronic
1061578393 9:131522167-131522189 AGGGAGCAGAAGGATTTGGAAGG - Exonic
1062633867 9:137479656-137479678 AGGGAGCAGAGGAGGGAGACGGG + Intronic
1186244555 X:7606971-7606993 AGCAAGCAGAAAAATGTGAAAGG + Intergenic
1186641625 X:11461772-11461794 ATGGAGCTGAAAGATGTGACTGG + Intronic
1187259844 X:17674931-17674953 GTGGAGCAGATGAATGTGAAGGG + Intronic
1187448526 X:19377632-19377654 AGAGAGCTGAAGGCTGTGACTGG - Intronic
1187805002 X:23109832-23109854 AAGGAGTACAGGAATGTGACAGG - Intergenic
1189119127 X:38375246-38375268 AGCAAGGAGAAGAATGTGTCTGG + Intronic
1189563362 X:42213904-42213926 AGGGTGCAGAAAGATGTGAGAGG + Intergenic
1192235909 X:69295989-69296011 AGGCTGCAGAAGCAGGTGACAGG - Intergenic
1193239635 X:79152554-79152576 AGAGAGCAAAAGAATGTGGTGGG - Intergenic
1196514656 X:116555650-116555672 AGGGAGGAGAAGAAAGTCAAAGG - Intergenic
1197734406 X:129840104-129840126 AGCCAGCAGAAGAATCTGACTGG - Intronic
1197993893 X:132351466-132351488 AGGAAGTAGTAGAATGGGACAGG + Intergenic
1198793885 X:140375176-140375198 AGAGAGTAGAAAAATGTCACAGG + Intergenic
1199394211 X:147315577-147315599 AGGAAACAGAAGAAAGTGAAGGG + Intergenic
1199653268 X:149969482-149969504 AGGGAGCAGTACAATATGACAGG - Intergenic
1199664096 X:150082863-150082885 TGGGAGCAGAGGGATGGGACTGG + Intergenic
1201306616 Y:12556173-12556195 AGGAAGCAGCAGAAAGTCACTGG + Intergenic
1201735380 Y:17254915-17254937 AGTGAGCAACAGAATGTTACTGG - Intergenic