ID: 1075925432

View in Genome Browser
Species Human (GRCh38)
Location 10:126248052-126248074
Sequence CTGTGCCACCAGCAGGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075925432_1075925435 -2 Left 1075925432 10:126248052-126248074 CCCTGCACCTGCTGGTGGCACAG 0: 1
1: 0
2: 3
3: 34
4: 257
Right 1075925435 10:126248073-126248095 AGCTCATTGCTGAAATTACTCGG No data
1075925432_1075925437 21 Left 1075925432 10:126248052-126248074 CCCTGCACCTGCTGGTGGCACAG 0: 1
1: 0
2: 3
3: 34
4: 257
Right 1075925437 10:126248096-126248118 GTGACATGACTTCCTTCTCTAGG No data
1075925432_1075925436 -1 Left 1075925432 10:126248052-126248074 CCCTGCACCTGCTGGTGGCACAG 0: 1
1: 0
2: 3
3: 34
4: 257
Right 1075925436 10:126248074-126248096 GCTCATTGCTGAAATTACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075925432 Original CRISPR CTGTGCCACCAGCAGGTGCA GGG (reversed) Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900679805 1:3910568-3910590 CTCGGCCACCAGCAGGTCCACGG - Intergenic
901238400 1:7679635-7679657 CTGTGTATCCTGCAGGTGCAGGG - Intronic
901398481 1:8999813-8999835 CTGAGTCCCCAGCAGGTCCAAGG - Intergenic
901512091 1:9722505-9722527 CTGTGCCACCGGCCGGTGGGAGG - Intronic
901649812 1:10737103-10737125 CTGTGGCCCCAGCAGCTGGATGG - Intronic
902519476 1:17007890-17007912 CTGTGCCCACAGCAGCTGCCTGG - Intronic
902561037 1:17277698-17277720 CTCTGCCCCCAGCAGGAGCCTGG + Intronic
903528307 1:24010006-24010028 ATGAGCCTTCAGCAGGTGCAGGG - Intergenic
903675609 1:25062818-25062840 CTGAGTCTCCAGCAGGGGCAGGG - Intergenic
903791374 1:25895488-25895510 CTGGGCCTCCAGCAGGGGCAGGG + Intronic
904612844 1:31734973-31734995 CTGTGCCTCCCACAGGTGCCCGG - Intronic
906733300 1:48101570-48101592 CTGTGCTCACAACAGGTGCACGG - Intergenic
907519313 1:55012752-55012774 GTGAGCCAACAGCAAGTGCAGGG + Intergenic
908813964 1:68012633-68012655 CTGTGCCTGCTGCAGGTGGAAGG - Intergenic
909082699 1:71132943-71132965 CAGTGAAACCATCAGGTGCAAGG - Intergenic
910992216 1:93067998-93068020 CTGTGCCAGAAACAGTTGCAAGG + Intergenic
912420704 1:109540506-109540528 CTGGGCCTCTAGCAGGGGCATGG - Intronic
912948883 1:114106889-114106911 CTGAAGCACAAGCAGGTGCAAGG - Intronic
913975266 1:143450579-143450601 CTATACCAGCAGCTGGTGCAGGG - Intergenic
914069659 1:144276195-144276217 CTGTACCAGCAGCTGGCGCAGGG - Intergenic
914109496 1:144690159-144690181 CTGTACCAGCAGCTGGCGCAGGG + Intergenic
915320334 1:155052657-155052679 CAGTGCCACCTGCAGGTCCCAGG - Exonic
916107672 1:161442785-161442807 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916109256 1:161450203-161450225 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916110842 1:161457584-161457606 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916112429 1:161464994-161465016 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916114014 1:161472375-161472397 TTGTGTCACCAGCAGGTGAGAGG - Intergenic
916519607 1:165551998-165552020 CTGGGCAACCAGCAGCTCCAAGG + Intronic
916727287 1:167534322-167534344 ATGTGCCACCAGCAGTTGAGGGG + Intronic
918493119 1:185104294-185104316 CTGTGCCAGCAGGAAGTGAAAGG + Intergenic
919940912 1:202285430-202285452 CTTTGCCACCAGCATGTGACAGG + Intronic
920670760 1:208002294-208002316 CTGTGCAGCCAGCAGATGCAGGG - Intergenic
922333697 1:224600925-224600947 CTGTAACACTAGCAGGTGGACGG - Intronic
922700181 1:227754704-227754726 CTGTGCCTCCTGAAGGAGCAGGG - Intronic
922792409 1:228317613-228317635 CTGTGCCACGAGCTGGTGCCTGG + Exonic
1064322602 10:14319930-14319952 CTGTGACTCCTGGAGGTGCAGGG - Intronic
1067247294 10:44557551-44557573 CTGTCCAAACAGCAAGTGCAGGG - Intergenic
1069625425 10:69864975-69864997 CTGAGGAAGCAGCAGGTGCATGG + Intronic
1069893161 10:71664490-71664512 CTGTGCCAGCAGCGGGTCCGTGG - Intronic
1070400082 10:76045569-76045591 CTCTGCCACCATCATATGCAAGG - Intronic
1070717382 10:78732567-78732589 CTCTGCCACCACCGGGTGGATGG + Intergenic
1072701769 10:97647105-97647127 TTCTGACACCAGCTGGTGCATGG + Intronic
1074417956 10:113283832-113283854 ATGAGCCACCAGCAGCTGGAAGG - Intergenic
1075925432 10:126248052-126248074 CTGTGCCACCAGCAGGTGCAGGG - Intronic
1075952863 10:126497119-126497141 CGGTGCCAGCAGGAGGTGCCAGG + Intronic
1075990665 10:126836201-126836223 CTGGGCCACCAGCAGGCTCTGGG + Intergenic
1076110750 10:127857254-127857276 CTGGCCCACCAGCATCTGCAAGG - Intergenic
1076754797 10:132563770-132563792 CTGTCTCACCAGCAAGCGCAAGG - Intronic
1077017828 11:404715-404737 CTGGGCCACCAGGAGGGGCAGGG + Exonic
1080671410 11:34382690-34382712 CTGTGCCACCCCTAGCTGCAAGG - Intergenic
1080974858 11:37326581-37326603 CTGAGGGAACAGCAGGTGCAAGG - Intergenic
1081688258 11:45057663-45057685 CTGTGACAGCAGCACGTCCATGG + Intergenic
1082812006 11:57483966-57483988 CAGAGGCACAAGCAGGTGCAGGG + Intergenic
1083200668 11:61119240-61119262 CTGTGCCACCAGCTGCAGCCTGG - Exonic
1084474077 11:69378843-69378865 CTGTGCCACCAGCTCTTGCAGGG - Intergenic
1084549579 11:69833153-69833175 CTGTCCCAGCTGCTGGTGCACGG + Intergenic
1088812111 11:113399063-113399085 CTGGGCCACCAGGAAGTGGAGGG - Exonic
1088979704 11:114851227-114851249 CTGAGCCACCAGCACATGAAGGG + Intergenic
1089641525 11:119850874-119850896 CTGTGCCATCACCAGGTGATTGG + Intergenic
1090620422 11:128555799-128555821 CACTGCCACCAGCAAGTGGAAGG + Intronic
1091564769 12:1640034-1640056 CTGTGCCACCAGCCGTGGCCTGG + Intronic
1092029877 12:5275276-5275298 CTGTGCCACAGGCTGGAGCAGGG - Intergenic
1092192829 12:6533262-6533284 TTGGCCCATCAGCAGGTGCATGG - Intergenic
1093749535 12:22782274-22782296 GTGTGCCATGAGCAGGTTCATGG - Intergenic
1095672829 12:44879867-44879889 CTTTGCCACTTGCAGGTACAAGG + Intronic
1095954601 12:47798905-47798927 CTGGCCCACCCGCAGGTCCATGG + Exonic
1096684354 12:53277938-53277960 CTTTGCCACCAGCTGGTAGAGGG - Exonic
1097699648 12:62807044-62807066 CAGTAGCAACAGCAGGTGCAAGG + Intronic
1098159177 12:67632068-67632090 TTGTTCCCCCAGCAGGAGCAGGG + Intergenic
1099551502 12:84050377-84050399 GTGTGCCAACAGCAGATGCAAGG + Intergenic
1103900034 12:124298688-124298710 GTGTGGCAGCAGCAGGTGGATGG + Intronic
1104110784 12:125702262-125702284 CTGTGTCCCCACCAGGTGGAGGG + Intergenic
1104405389 12:128512233-128512255 CTCTTCCAGGAGCAGGTGCACGG - Intronic
1104494044 12:129219888-129219910 CTGTGCTCCCAAAAGGTGCAAGG - Intronic
1104559964 12:129834545-129834567 CAGTGCTAGCAGCTGGTGCATGG - Intronic
1104567745 12:129900520-129900542 CTTTCCTACCAGCATGTGCAAGG + Intronic
1104641842 12:130472015-130472037 CTTTGCCACCAGGAGGGTCAGGG + Intronic
1105579835 13:21684925-21684947 CTGTTCCTCCAGCAGGTGAGGGG + Intronic
1105874709 13:24541458-24541480 CAGTCCCACCCGCGGGTGCAGGG - Intergenic
1106411199 13:29512850-29512872 CTGTGCCCCCAGAAGGTTCTTGG - Exonic
1107740698 13:43446815-43446837 CTGTGCCCCCAGGATGGGCATGG - Intronic
1108564030 13:51676418-51676440 CTGTACCTCCAGCTGGTGAAGGG + Intronic
1112507364 13:99982900-99982922 GTGTGTCACCAGCTCGTGCATGG - Exonic
1113765748 13:112880273-112880295 CTCTGCCTCCCGCGGGTGCATGG + Intronic
1118098498 14:62567537-62567559 CTGCTCTTCCAGCAGGTGCATGG - Intergenic
1119617466 14:76108141-76108163 CTGAGCCAGCTGCAGGGGCAGGG + Intergenic
1121560053 14:94867973-94867995 CTGTTCCCCCAGTAGGTGCAAGG - Intergenic
1121724947 14:96140376-96140398 GTGTTCCACCAGCAGGTCCTGGG - Intergenic
1121781477 14:96624971-96624993 CTGTGCGAGCACCAGGGGCAGGG - Intergenic
1122369605 14:101222065-101222087 CTAGGCCCCCAGCAGGGGCAGGG - Intergenic
1122447631 14:101781339-101781361 CTGTGCCACCGGGAGGCGCAGGG - Intronic
1123032277 14:105457539-105457561 CTGTGCCCCCAGAAGGTCCCTGG + Intronic
1123154318 14:106209838-106209860 CTGTGCTCCCTGCAGGTGGAGGG - Intergenic
1125742070 15:41972288-41972310 CTGGCCCACCAGCAGGATCATGG + Exonic
1126112016 15:45180972-45180994 CTGTGTCACCAGAAGCTGCTTGG + Intronic
1128443034 15:67731259-67731281 CTGTGTCACCAGCAGGAAGAGGG - Intronic
1130272649 15:82460056-82460078 CAGTGCCACCAGGATGCGCAGGG - Intergenic
1130465001 15:84187409-84187431 CAGTGCCACCAGGATGCGCAGGG - Intergenic
1130487687 15:84407395-84407417 CAGTGCCACCAGGATGCGCAGGG + Intergenic
1130499264 15:84486128-84486150 CAGTGCCACCAGGATGCGCAGGG + Intergenic
1130587291 15:85192023-85192045 CAGTGCCACCAGGATGCGCAGGG - Intergenic
1132372587 15:101308753-101308775 CTGGGCCACCAGAATGTGCAAGG - Intronic
1133160646 16:3909356-3909378 CTGTGCCACAGGCCGGAGCACGG - Intergenic
1133652767 16:7828590-7828612 CTGTGCCCCCAGCATGTGGTGGG + Intergenic
1136716539 16:32287405-32287427 CTGTCCCACAAGGAGGTGCCCGG + Intergenic
1136834927 16:33493683-33493705 CTGTCCCACAAGGAGGTGCCCGG + Intergenic
1137439365 16:48484863-48484885 ATCTGACACCAGCAGGTGCTGGG + Intergenic
1137670432 16:50275229-50275251 CTGGCCCACAGGCAGGTGCATGG + Intronic
1137729806 16:50681096-50681118 CCCTGCCCCCAGCAGGTGCCAGG + Intronic
1138445170 16:57059004-57059026 CAGTGTCTCCAGCAGGTACAGGG - Exonic
1140388196 16:74561148-74561170 CTCTGACACCAGCAGGAGGAAGG - Intronic
1141455036 16:84135799-84135821 CTGTGCCCCCAGCAGACGCCAGG - Intronic
1142006643 16:87692458-87692480 CTGGGCCACCAGCAGGGTCTGGG + Intronic
1142045982 16:87925573-87925595 CAGTGACACCAGCTGGTGCTGGG + Intronic
1142065328 16:88059167-88059189 CCCCGCCACCAGCAGGAGCATGG - Intronic
1142153372 16:88522397-88522419 GTGGGCCAGCAGCAGGTTCACGG - Intronic
1203009876 16_KI270728v1_random:230349-230371 CTGTCCCACAAGGAGGTGCCCGG - Intergenic
1142708081 17:1709048-1709070 CTCTGCCCCCAGCTGGTGCTTGG - Intronic
1144678552 17:17177321-17177343 CTGTGACATCAGCAGGTTGAAGG + Exonic
1145351462 17:22088489-22088511 CTCTGGCACCAGCAGGAGGAGGG + Intergenic
1147586626 17:41656877-41656899 CAGGGCCACCAGCAGGGCCAGGG - Intergenic
1148054586 17:44786629-44786651 CTGGGCCACCACTGGGTGCAGGG + Intergenic
1148149341 17:45387084-45387106 ATGTTCCACCACCAGGTGCTGGG + Intergenic
1148159353 17:45441305-45441327 CTGAGCCACCAGCTGGGACAAGG - Intronic
1149993466 17:61395475-61395497 CTCTGCCACCAGCAGGTACGTGG + Intergenic
1150136358 17:62697411-62697433 CTCTGCCATCAGCCGATGCAAGG - Intergenic
1151821052 17:76497157-76497179 CTGTGCCAGCAGGTGGTGCAGGG - Intronic
1152149730 17:78591452-78591474 CTGTGCCTCCTGCTGCTGCAGGG + Intergenic
1152405335 17:80095111-80095133 CTGTGCCGCCAGGAGGAACAAGG - Intronic
1152469433 17:80482674-80482696 CTGAGCCAGCACCAGGCGCATGG + Intergenic
1152612530 17:81322792-81322814 CGGTGGCAGCAGCTGGTGCAGGG - Intronic
1153284873 18:3448461-3448483 CTGTGCTCCCGGCAGTTGCAGGG + Intronic
1153773475 18:8433528-8433550 CTGTGCCTCCAGCAGGTCACCGG + Intergenic
1153925154 18:9828978-9829000 CTGTGACAGCAGCAGGTAAATGG - Intronic
1156488632 18:37483146-37483168 GTGTGCCACTAGCAAATGCAGGG - Intronic
1157577386 18:48752676-48752698 CTGTGCCACTCACAGTTGCATGG - Intronic
1157717359 18:49897203-49897225 CTGTGACACCTGCAGGTGCAAGG - Intronic
1159415902 18:68149044-68149066 CTGTGCCACCAGCTGCTGCTGGG - Intergenic
1160015674 18:75138515-75138537 CCGTACCACCACCAGGAGCAGGG - Intergenic
1160173490 18:76573367-76573389 ATCTGCCACAGGCAGGTGCAGGG + Intergenic
1160551406 18:79695963-79695985 CTCTGCAACCTGCAAGTGCAAGG - Exonic
1160932569 19:1577633-1577655 CTGTGGCACCACCAGCCGCATGG + Exonic
1161355598 19:3817820-3817842 CTTTGCAACCCACAGGTGCAAGG + Intronic
1161979034 19:7621014-7621036 CTGTGCGTACAGCAGGTACAAGG + Exonic
1162194456 19:8973624-8973646 CTGTTCCAGCACCAGGTACATGG - Exonic
1163710436 19:18843351-18843373 CTGAGGGAACAGCAGGTGCAAGG + Intronic
1165708548 19:37993268-37993290 CTGTGCCAAGAGCTGGTTCAAGG - Intronic
1166105640 19:40596932-40596954 CTGTTCCACGAGAAGGTTCACGG + Intronic
1167161521 19:47770515-47770537 CTGGGCCAGCACCAGGTGCTTGG - Intergenic
1168189278 19:54726233-54726255 CTGTGACCCCAGCACATGCAGGG + Exonic
1168197515 19:54786643-54786665 CTGTGACCCCAGCACATGCAGGG + Intronic
1168206174 19:54852178-54852200 CTGTGACCCCAGCACATGCAGGG + Exonic
925238340 2:2298684-2298706 CTGTGCCACCAGCAGCTTCCTGG + Intronic
925292280 2:2755869-2755891 CAGTCCCACCAGCAGGGGTAGGG - Intergenic
925824282 2:7832303-7832325 CTGTGTTACCAGAAGGAGCATGG + Intergenic
927151733 2:20200144-20200166 CTGCTCCATCAGCAGGTGCAGGG + Intergenic
927981506 2:27377687-27377709 AAGCGCCACCAGAAGGTGCATGG - Exonic
929286055 2:40136314-40136336 ATTTGCTACCAGCTGGTGCAAGG + Intronic
929565187 2:42979542-42979564 CTCTGCAACCCGCAGCTGCATGG - Intergenic
931786205 2:65621505-65621527 ATATGCCTCCAGCTGGTGCATGG + Intergenic
934989375 2:98910754-98910776 CGAGGCCACCAGCAGGTGAATGG - Intronic
935820992 2:106892643-106892665 CTGTGCCCCCACCATGTGCAAGG + Intergenic
936938222 2:117858728-117858750 CCGTGCCACCAGCAGGTCCGAGG + Intergenic
937315519 2:120929823-120929845 CTCAGCCACCTGCAGGTGGAGGG - Intronic
941583724 2:167331509-167331531 GTATGCCACCTGCAGGTCCAGGG - Intergenic
942259498 2:174144266-174144288 CAGTGCCACCAGCATATGTAAGG - Intronic
944382787 2:199130974-199130996 CTTTGCCACCAGCATGTGGGTGG - Intergenic
948798642 2:240420179-240420201 CTCTGCCACCAGCTGGGGCTTGG - Intergenic
1169340104 20:4790087-4790109 CTGTGCCCCCAGCTGGTGTATGG - Intronic
1170498526 20:16950686-16950708 CTGTGCCACCAGCTGATGCAGGG - Intergenic
1173164893 20:40680999-40681021 CTGTAACACCAGCAGAAGCAGGG + Intergenic
1174376574 20:50130044-50130066 CTGTTACCCCAGCAGGTGCAGGG - Intronic
1174430035 20:50460924-50460946 CTGGGCCACCAGGAGGCGCTAGG - Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175265300 20:57699533-57699555 CTGTGCAACTACCAGGTGCCAGG + Intronic
1175417513 20:58811496-58811518 CTCTGCCGCCAGCCGGTGCGTGG + Intergenic
1176188541 20:63795297-63795319 TTGTGCCCCCAGCACCTGCACGG - Intronic
1176294293 21:5062794-5062816 CTGTGGCACGAGCAGGTAGACGG - Intergenic
1176359453 21:5982804-5982826 ATGTGCCACCTGCAGGTCCAAGG - Intergenic
1179727858 21:43350368-43350390 CTGTGCCACCCCCAGGTGGCTGG + Intergenic
1179764065 21:43555746-43555768 ATGTGCCACCTGCAGGTCCAAGG + Intronic
1179862967 21:44200854-44200876 CTGTGGCACGAGCAGGTAGACGG + Intergenic
1180570936 22:16718133-16718155 CTGCGCCACCACCAGGAGAAGGG - Intergenic
1181237392 22:21455883-21455905 CTGGGCCACCAGCAGGGCCCAGG + Intergenic
1181711610 22:24695143-24695165 CTGAGCCACCAGGGGGTGCGCGG + Intergenic
1182485576 22:30636701-30636723 GGCTGCCACCAGCATGTGCAGGG - Exonic
1183778509 22:39983676-39983698 TTGTGCAGCCAGCAGGAGCAGGG - Intergenic
1183987395 22:41577081-41577103 CTGGGCCACCAGGTGGAGCATGG + Exonic
1184072598 22:42155172-42155194 CTGTGCTGCCAGTGGGTGCAGGG + Intergenic
1184224795 22:43123351-43123373 CTGTGCTGACAGCAGGTGCCTGG + Intronic
1184388638 22:44190578-44190600 CAGGGCCACAAGGAGGTGCAGGG - Exonic
1185250876 22:49801030-49801052 CAATGCCGCCAGCAGGTGCGTGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
1185395619 22:50585963-50585985 ATGTCCCACCAGCAGGTGCTCGG - Intronic
950181104 3:10914067-10914089 CTGTCCCACCAGCAGGGGTATGG - Intronic
950245536 3:11413836-11413858 CAGTGGAACCATCAGGTGCAGGG + Intronic
950713673 3:14832288-14832310 CTGTGACAACACCTGGTGCAGGG - Intronic
953355774 3:42255112-42255134 CTATGCCACCTGCTGTTGCAGGG - Intergenic
953927874 3:46991555-46991577 CTGGGCCACGAGGAGGTGCGCGG - Exonic
954237734 3:49269785-49269807 TTGGGGCACCAGCAGGTGCCAGG + Exonic
956253890 3:67263573-67263595 CAGTGCTACCAGCAGGAACATGG - Intergenic
957615778 3:82524870-82524892 CTGAGACACCAGGAAGTGCAGGG - Intergenic
961477526 3:127158006-127158028 CTGAGGCAACAGCAGGTGAAAGG + Intergenic
962204972 3:133426832-133426854 ATGTGCCTCCAGCAAGTACAGGG + Intronic
962990303 3:140572001-140572023 CTGTGCCAGCAACAGGGGAAGGG + Exonic
967887503 3:194343070-194343092 CTGTGCAAAGAGCAGGTGCCAGG - Intronic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
968737325 4:2304165-2304187 CTTGGCCACCGGCAGGTGCTGGG - Intronic
969234222 4:5853938-5853960 CTGGGTCACCAGCAGGCGAATGG - Intronic
969542094 4:7798766-7798788 CTGTGCCCCCAGCAATGGCAGGG + Intronic
969675217 4:8610722-8610744 CTGCCCCACCCACAGGTGCAGGG + Intronic
973695792 4:53489458-53489480 CTCAGCCACCAGCAGATTCAGGG - Intronic
981041814 4:140230164-140230186 CTCCTCCACCAGCAGGTCCATGG + Intergenic
985495130 5:199896-199918 CTGCTCCAGGAGCAGGTGCAGGG - Exonic
985750600 5:1672021-1672043 CTGTGCCACCCCCAGCTTCACGG + Intergenic
989182426 5:38591967-38591989 CTGTGCCACCAACCAGTCCAGGG - Intronic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
991244051 5:64490054-64490076 TTGTGACACCAGCAGGGGCAGGG - Intergenic
993307403 5:86289767-86289789 CAGGGCCTACAGCAGGTGCAAGG - Intergenic
995591061 5:113699941-113699963 CTGTGGGAGAAGCAGGTGCAGGG - Intergenic
996146625 5:119984969-119984991 CTGTGCACCCATCATGTGCAAGG - Intergenic
999142922 5:149374552-149374574 CCGTGCCTCCGGCAGGTCCACGG + Exonic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000014867 5:157267256-157267278 CTGTGCCCTCAGCATGGGCAGGG + Intronic
1001047093 5:168382550-168382572 CTGTGCCAGCTGGAGGTGTAGGG + Intronic
1002000403 5:176193698-176193720 CTGTGCTGACAGCGGGTGCAGGG - Intergenic
1002296418 5:178233513-178233535 CTGGGACTGCAGCAGGTGCAGGG + Intergenic
1005271308 6:24166327-24166349 ATGTGCCACCTGCCAGTGCAAGG + Intergenic
1006171496 6:32095893-32095915 CTGTGCCACCCGCATGTGCCCGG - Intronic
1006189904 6:32201347-32201369 CAGTACCACCAGCAGGGCCAGGG + Exonic
1006375757 6:33670927-33670949 CTGTGTCCCCAGCCAGTGCAGGG + Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1008574597 6:52848136-52848158 CTGTGCCATCAGCACCAGCATGG + Intronic
1010657730 6:78531970-78531992 TTCTGCCACCAGAAGATGCAGGG - Intergenic
1010722175 6:79295876-79295898 CTGTGAAACCATCTGGTGCAGGG + Intergenic
1011212146 6:84966682-84966704 CTGCCCCACCAGCTGGTCCAGGG - Intergenic
1014532925 6:122580951-122580973 CTGTGCTACCACTAGGTGGATGG + Intronic
1015030236 6:128586260-128586282 CTGAGACACCAGCTGGGGCAGGG + Intergenic
1018716065 6:166533514-166533536 CAGTGACACCAGCAAGGGCAGGG + Intronic
1018809248 6:167285594-167285616 CTGAGACAGCAGCAGCTGCAGGG - Intronic
1018952837 6:168390459-168390481 ACGGGGCACCAGCAGGTGCAGGG - Intergenic
1019483431 7:1276646-1276668 CTGTGCCCCCAGCAGGGTGATGG + Intergenic
1019783369 7:2958056-2958078 CTGTGACACCAGCCGGAGCTTGG - Intronic
1020430651 7:8113391-8113413 CTGTCCCCACAGCAGGTGCCTGG - Exonic
1021543497 7:21786973-21786995 CAATGCCAGCAGCAGGTGGAAGG + Intronic
1024852787 7:53741026-53741048 CTGTGGCATCAGTAGGTGCAGGG - Intergenic
1026575398 7:71567273-71567295 CTGCTACACCAGCAGGAGCAAGG + Intronic
1027250134 7:76393709-76393731 CTGTGCGCCCCGCAGGTGGACGG - Exonic
1028163388 7:87510721-87510743 TTGTGACACTGGCAGGTGCAGGG + Intronic
1028754443 7:94419521-94419543 CTGTGGCTCCAGCAGGACCAGGG - Exonic
1029328545 7:99831506-99831528 TTGTGGCACCAGCAGTTGCATGG + Intronic
1029490737 7:100868637-100868659 CTGTGCCACCTTCACTTGCACGG - Exonic
1030408398 7:109143634-109143656 CTGAGACACCAGCTGGGGCATGG - Intergenic
1033566133 7:142579944-142579966 CTGTGCCAACAGCAGAGACATGG + Intergenic
1034034375 7:147803410-147803432 CGGTGCCACCAGCAGGTCCACGG - Intronic
1034520010 7:151612554-151612576 CTGTCCCATCAGCAGGCGTAGGG + Intronic
1034859201 7:154581708-154581730 CAGTGTCCCCTGCAGGTGCAGGG + Intronic
1034989151 7:155536647-155536669 CTGTTCATCCAGCAGGTGGATGG - Intergenic
1035022475 7:155807701-155807723 ATGTCCCACCAGCAGCAGCAGGG - Intronic
1037399202 8:18476648-18476670 CTCTGCCACCAGCTGGTGTGAGG + Intergenic
1037606363 8:20441006-20441028 CTGTGCCCCCAGCACGTGGGAGG - Intergenic
1039778533 8:40760804-40760826 CTGTGCAACTTGCAGGTGCATGG - Intronic
1044929693 8:97239974-97239996 CTGAGCCACCAGCAGAGGCAAGG - Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047348505 8:124051344-124051366 CTGAGGCACCAGGAGGTGCCTGG - Intronic
1048967106 8:139623381-139623403 CTGTGCCAAGAGCAGGTCCCAGG - Intronic
1049158170 8:141079886-141079908 CATTCCCACCAGCAGGTCCAAGG + Intergenic
1049164278 8:141116858-141116880 CTGAGCCACCTGCAGGTTCCTGG + Intergenic
1049355505 8:142186344-142186366 CCATGCCCCCAGCAGGAGCATGG + Intergenic
1049514298 8:143045297-143045319 CAGGGCCACCAGCAGGACCAGGG + Intronic
1049670681 8:143868430-143868452 CTGTGCCTCCAGCAGCACCAGGG + Exonic
1049671132 8:143870353-143870375 CTGGGCCTCCAGCAGGGCCAGGG + Exonic
1049729831 8:144170769-144170791 CTGTGCCACCAAGGGGTGCTGGG + Intronic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1051547563 9:18293489-18293511 CTGTGCTACCAGCAGGCCCACGG - Intergenic
1056812701 9:89776690-89776712 ATGTGGCACCAGCACTTGCAGGG + Intergenic
1057080766 9:92172914-92172936 CAGGGGCACCAGCAGGTGCAAGG - Intergenic
1057237587 9:93376212-93376234 CTGTGAAGCCATCAGGTGCAGGG + Intergenic
1058175114 9:101726424-101726446 CTGTACCACCAGAAGGTGTTTGG - Intronic
1060103609 9:120860201-120860223 CCGGGCCACCAGCAGGCTCACGG - Intronic
1060558935 9:124526932-124526954 CTGTGACACCAGTAGGGGCCAGG + Intronic
1060942259 9:127549806-127549828 CTCAGCGAGCAGCAGGTGCAGGG + Intronic
1060942649 9:127551941-127551963 CTCAGCCAGCAGCAGGTGCAGGG + Intronic
1061135139 9:128729453-128729475 CTGTGCCACCATCAGGGAGAAGG - Intergenic
1061442820 9:130618216-130618238 CCGTGCCACCAGCAAGAGCTCGG - Intronic
1061779891 9:132989287-132989309 CTGTGTCACCCCCAGGGGCAGGG - Intronic
1061843141 9:133371779-133371801 CTGTGCCACCTGCAAGTTCAGGG + Intronic
1185495689 X:553295-553317 CCCTGCCACCAGCAGCTGCCAGG - Intergenic
1187607785 X:20905486-20905508 TTGTGCCAGCAGCAGTGGCATGG + Intergenic
1187929074 X:24277398-24277420 ATGTGCCGCCAGCAGATGCGGGG - Intergenic
1188979571 X:36714901-36714923 AAGTACCACCAGAAGGTGCATGG + Intergenic
1192551613 X:72059126-72059148 CTGGAAAACCAGCAGGTGCAGGG - Intergenic
1195577395 X:106467387-106467409 CTGTGCCAATAGAAGTTGCAAGG + Intergenic
1198794892 X:140384380-140384402 CTGTGCTACCTGTAGGTGCTTGG + Intergenic