ID: 1075925441

View in Genome Browser
Species Human (GRCh38)
Location 10:126248128-126248150
Sequence CCTCATCTGCAGATTGAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075925438_1075925441 -3 Left 1075925438 10:126248108-126248130 CCTTCTCTAGGCCTCAGTGTCCT 0: 1
1: 17
2: 187
3: 910
4: 2452
Right 1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075925441 Original CRISPR CCTCATCTGCAGATTGAGTG TGG Intronic
No off target data available for this crispr