ID: 1075926726

View in Genome Browser
Species Human (GRCh38)
Location 10:126257091-126257113
Sequence GTGTCAGTGTTCAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075926726_1075926732 3 Left 1075926726 10:126257091-126257113 CCTTCCTCCCTGAACACTGACAC No data
Right 1075926732 10:126257117-126257139 CTGTATGTGTACTGCCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075926726 Original CRISPR GTGTCAGTGTTCAGGGAGGA AGG (reversed) Intronic
No off target data available for this crispr