ID: 1075929039

View in Genome Browser
Species Human (GRCh38)
Location 10:126278953-126278975
Sequence TGCTGAATATTCGACTACAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 71}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075929039_1075929041 30 Left 1075929039 10:126278953-126278975 CCGTTGTAGTCGAATATTCAGCA 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1075929041 10:126279006-126279028 AAAGTCAGTTGAAAAACGCTTGG 0: 1
1: 0
2: 1
3: 6
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075929039 Original CRISPR TGCTGAATATTCGACTACAA CGG (reversed) Exonic
906748572 1:48238956-48238978 TGGTTAATATTCAACTAAAATGG - Intronic
910634440 1:89391451-89391473 TGCTGAATTTTCTACCACCAAGG + Intergenic
911491073 1:98566788-98566810 TCCTGGATATTCTAATACAATGG - Intergenic
1064693742 10:17944615-17944637 TGCAGAATATTCAACTGAAAAGG - Intergenic
1065175982 10:23075675-23075697 TGCTGAATTTTAGACCAGAAGGG - Intergenic
1068871684 10:61951911-61951933 TGCTGAATATTTCATTACAGAGG + Intronic
1075929039 10:126278953-126278975 TGCTGAATATTCGACTACAACGG - Exonic
1077771637 11:5225424-5225446 TTCTGAATATTTTACTAAAAAGG - Intergenic
1080213995 11:29820130-29820152 TGATGTATAATCTACTACAATGG + Intergenic
1081210283 11:40324920-40324942 AGCTGAATATTCCACTTCATAGG + Intronic
1085902407 11:80717125-80717147 TGTAAAATATTAGACTACAAAGG - Intergenic
1089105282 11:115997956-115997978 TTCTGAATATTCCCCTCCAATGG + Intergenic
1093043481 12:14413457-14413479 TGCTGAACATTCTATTAAAATGG + Intronic
1093889007 12:24497244-24497266 TGCTGAATAAATGGCTACAAGGG + Intergenic
1099228755 12:79999435-79999457 TACTGAATATTCAACTCCACAGG - Intergenic
1100580422 12:95934607-95934629 TGCAGAATATTAGACTAGTATGG - Intronic
1105672071 13:22630241-22630263 TGCTAAATATTTGACCACTAGGG - Intergenic
1109759641 13:66811338-66811360 TGCTTAATATAGGACCACAAGGG - Intronic
1117567407 14:57008974-57008996 TGCAGAATATGAGACAACAATGG + Intergenic
1127774340 15:62253712-62253734 TGCTGATTATGCCACTGCAAGGG - Intergenic
1129090622 15:73146294-73146316 TGCTGTGTATTTGACCACAACGG + Intronic
1129622226 15:77158509-77158531 TGCTGTATGTTGCACTACAAGGG + Exonic
1131913435 15:97234501-97234523 TGCCGAAGATTCGTTTACAATGG - Intergenic
1145197428 17:20907224-20907246 TGTTGTATATTTTACTACAATGG + Intergenic
1151203419 17:72486756-72486778 TGTTAAATATTCTTCTACAATGG - Intergenic
1156658670 18:39318916-39318938 TGCTGAATTTTAGACAAAAATGG - Intergenic
926363110 2:12108738-12108760 TGCTTAATATTTGTCTTCAATGG - Intergenic
932539122 2:72633142-72633164 TGCTTAATATTTGATCACAAAGG - Intronic
932893524 2:75616368-75616390 TTCTGAATATTCTATTACATTGG + Intergenic
933604904 2:84372378-84372400 TGCTGGATATTAGAATACAATGG - Intergenic
945099069 2:206247345-206247367 TGCTAAATATTTGAATAAAAAGG - Intergenic
948274850 2:236700512-236700534 GGCTGCATATTCGTCTAGAAGGG - Intergenic
1169674159 20:8134963-8134985 TGCTGATCAGTGGACTACAAGGG + Intronic
1172398313 20:34626050-34626072 TGCATAATATTCTACTACATGGG + Intronic
949715621 3:6927810-6927832 TGCTGAATATTCCAATATATGGG + Intronic
951005164 3:17607592-17607614 TGCTGAATAGGGGACTAAAAGGG - Intronic
956040495 3:65140170-65140192 TGCTGAATAATAGAACACAAGGG - Intergenic
956263155 3:67367617-67367639 TGCTGAACATTCTACAACACAGG - Intronic
959780695 3:110229590-110229612 TGTTTAATATTCAACTAGAAAGG - Intergenic
960848988 3:122032327-122032349 TGCAGTATATTCTAATACAATGG - Intergenic
962507066 3:136058140-136058162 TACTGAATGATCAACTACAATGG + Intronic
962803227 3:138908146-138908168 TGGTGAATATTAAACTGCAATGG - Intergenic
967123675 3:186406081-186406103 TGCTGAATATTTGACTAAAGAGG - Intergenic
970049572 4:11898176-11898198 TGCTGGATTTTCGACTTGAATGG + Intergenic
974542216 4:63251624-63251646 TGCTGAATTTTCTGCTACCATGG + Intergenic
975327750 4:73079088-73079110 TGCAAAATGTTCAACTACAAAGG + Intronic
976089815 4:81445281-81445303 AGCTAAATATTCATCTACAAAGG - Intronic
977112740 4:92979718-92979740 TTCTGCATTTTCAACTACAAGGG + Intronic
979552143 4:122003238-122003260 TGCTGAATAAACAAGTACAAAGG + Intergenic
980066815 4:128198186-128198208 TGCAGCATATTAAACTACAATGG - Intronic
980270902 4:130582486-130582508 TGCTGAGAAATCAACTACAAAGG - Intergenic
991335948 5:65547434-65547456 TGCTAAATATACTACTAAAAAGG + Intronic
993321613 5:86476121-86476143 TGCTGTAAATTTGACTAGAATGG + Intergenic
995846545 5:116499902-116499924 TGCTAAATCATCGAGTACAAGGG + Intronic
1002893705 6:1361382-1361404 TGCTGCATATTCAATTACAGTGG - Intergenic
1007478828 6:42136797-42136819 TGCTGAAGATTCGACTGGAGTGG + Intronic
1012247716 6:96944484-96944506 AACTTAATATTCTACTACAATGG + Intronic
1014484539 6:121983126-121983148 TGCTGAATATAACACAACAATGG + Intergenic
1016636468 6:146297845-146297867 TGCTGACTATTCTGCTACCATGG + Intronic
1017261824 6:152396348-152396370 TGGTGAATATACGATTAGAAGGG - Intronic
1022196822 7:28076255-28076277 TGCTTAATGTTCAACCACAATGG + Intronic
1024783415 7:52878142-52878164 TGCTCAAGATTTAACTACAAAGG + Intergenic
1030818153 7:114061987-114062009 GGCTAATTATTTGACTACAAAGG + Intronic
1032690915 7:134285692-134285714 TGTTGAATAGTCCACTACAGGGG + Intergenic
1039974312 8:42347916-42347938 TGCTGAATGTTTAACTAAAAAGG + Intronic
1041001001 8:53453155-53453177 TGCTGAAGAATAGACTACACAGG - Intergenic
1042058320 8:64789675-64789697 TGCTAAATATTCTACTGCAAAGG + Intronic
1042408212 8:68430668-68430690 TGATGAATTTTAGACTAAAATGG + Intronic
1048248926 8:132841412-132841434 TTCTGAATATTAAACTACTAGGG + Intronic
1048534145 8:135276708-135276730 TGCTCATTATTCTACTACTAGGG - Intergenic
1060931737 9:127493603-127493625 TCCCGAATACTCGACTACAAAGG - Intronic
1187996659 X:24934239-24934261 TGCTGAATAAACAACAACAAAGG - Intronic
1191157151 X:57286295-57286317 TACTGAATATTTGCATACAAAGG + Intergenic
1195694957 X:107660121-107660143 GGATGAATTTTCGACCACAAAGG - Intergenic
1197499157 X:127222626-127222648 TGCTGAATTTTGGACTCAAATGG + Intergenic
1197977855 X:132184390-132184412 TGCTGAATATTCAGCTAGAGAGG + Intergenic