ID: 1075933837

View in Genome Browser
Species Human (GRCh38)
Location 10:126322894-126322916
Sequence CCTCATATAACCCATCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075933837_1075933841 -6 Left 1075933837 10:126322894-126322916 CCATAATGATGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1075933841 10:126322911-126322933 ATGAGGTCTGGTGCAGGAGTTGG No data
1075933837_1075933844 18 Left 1075933837 10:126322894-126322916 CCATAATGATGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1075933844 10:126322935-126322957 GCCTCCAGCAGCCTCCTGTGTGG No data
1075933837_1075933842 -5 Left 1075933837 10:126322894-126322916 CCATAATGATGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1075933842 10:126322912-126322934 TGAGGTCTGGTGCAGGAGTTGGG No data
1075933837_1075933843 -4 Left 1075933837 10:126322894-126322916 CCATAATGATGGGTTATATGAGG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1075933843 10:126322913-126322935 GAGGTCTGGTGCAGGAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075933837 Original CRISPR CCTCATATAACCCATCATTA TGG (reversed) Intronic
916486708 1:165265967-165265989 CCTTAAATAACCAATCATTTAGG - Intronic
917647256 1:177041326-177041348 CCACATATAACCCATGTGTATGG + Intronic
921796987 1:219357448-219357470 CTTCACATCACACATCATTAAGG + Intergenic
924315649 1:242792623-242792645 CCTAATATAACCCCTCATATAGG + Intergenic
1066089041 10:31999700-31999722 CCTCATATGGCCCATCAGAAGGG - Intergenic
1069011866 10:63383404-63383426 TCTAATAAAACCCATCGTTAAGG + Intronic
1075933837 10:126322894-126322916 CCTCATATAACCCATCATTATGG - Intronic
1077608316 11:3627161-3627183 CCTCAGTTTTCCCATCATTAAGG + Intergenic
1080919109 11:36690915-36690937 CCTCATACAAGCCACCATCAGGG - Intergenic
1080992912 11:37561214-37561236 CCTCATGTAATCCATCAGCAAGG + Intergenic
1081206654 11:40283570-40283592 CCTGATCTAACACATCTTTAAGG - Intronic
1081466229 11:43320410-43320432 CCACAGAGAAGCCATCATTAGGG - Intronic
1086912589 11:92490180-92490202 CTGCATATAAGCCAGCATTAAGG - Intronic
1087784859 11:102343097-102343119 TTTCATAAAACCCTTCATTAGGG - Intergenic
1090912176 11:131130678-131130700 CCTCAGTTGACCCATCCTTAGGG - Intergenic
1091895612 12:4101394-4101416 CTTAATATCACACATCATTAGGG + Intergenic
1093698417 12:22189757-22189779 CCTCATTCTACCCAACATTAAGG + Intronic
1093788783 12:23222432-23222454 ACTCATATCAACCATAATTAGGG - Intergenic
1096440149 12:51635268-51635290 GTTCACATAACCCAGCATTAGGG - Intronic
1098698030 12:73583978-73584000 CCTCATATACCCCTTCATTTTGG + Intergenic
1101471848 12:105004656-105004678 CCTCATTAAACCCATCTTGATGG - Intronic
1106746394 13:32712955-32712977 ACTCATATAACTCATCGTTATGG - Intronic
1108759736 13:53548213-53548235 CTTAATATCACTCATCATTAGGG - Intergenic
1109700256 13:66015557-66015579 CATCATATACCACATCATTCAGG + Intergenic
1109881755 13:68487329-68487351 CTTCATTTAACCCATCACTCAGG + Intergenic
1110612967 13:77509540-77509562 CCTCATGTAACCAATCTATAAGG - Intergenic
1115485949 14:33911475-33911497 CTTCATTTAACCCAACACTAAGG - Intergenic
1119892467 14:78193237-78193259 TCTCATTTAACCCCTCATTCTGG + Intergenic
1121548914 14:94783447-94783469 CCTCAGCTAACACCTCATTATGG + Intergenic
1130673547 15:85933236-85933258 CATCATATAACACGTCCTTAAGG + Intergenic
1132422529 15:101684600-101684622 CCTCAAACATGCCATCATTATGG + Intronic
1146989814 17:37259492-37259514 ACTCACATAACCCACCATTTTGG + Exonic
1156225900 18:35107360-35107382 CCTTAGAAAACCCAACATTAAGG - Intronic
1156276625 18:35589551-35589573 CCTCATATATCCCAGCTTTCTGG - Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925329044 2:3044034-3044056 CCTCACATGACCCACCTTTAGGG - Intergenic
936693366 2:114919057-114919079 CCTCATTTAATCCATCAGAAAGG - Intronic
937664902 2:124475384-124475406 CCTCATGAAACTCATTATTAGGG - Intronic
940704777 2:157090570-157090592 CCTCTTAATAGCCATCATTAGGG + Intergenic
941080098 2:161050662-161050684 CCTCATATAACCAATCTGAAAGG + Intergenic
941613534 2:167692224-167692246 CATCATATAATCCAAAATTAAGG + Intergenic
941870718 2:170382362-170382384 GCTGATATAATCCATCATTAAGG - Intronic
942329381 2:174806051-174806073 CCTCCAGTAACCCAACATTATGG - Intronic
942522795 2:176821737-176821759 CGTCAAATAGCACATCATTAAGG + Intergenic
1169230817 20:3888128-3888150 CCTGCTACAACCAATCATTATGG + Intergenic
1170762831 20:19265861-19265883 CCTCTCAGAACCAATCATTATGG + Intronic
952146362 3:30537152-30537174 CCTCATATGCCTCATCTTTAAGG + Intergenic
954937127 3:54336699-54336721 CTCCCTAGAACCCATCATTAGGG + Intronic
957163957 3:76646743-76646765 CCTTAGACAAACCATCATTATGG - Intronic
965694131 3:171389577-171389599 GCCCATTAAACCCATCATTAGGG + Intronic
967596574 3:191331750-191331772 CCTAATATAACTCTTAATTATGG + Intronic
974879734 4:67740214-67740236 CCTCATATAACACATTATGTAGG - Exonic
983832631 4:172347289-172347311 TATCCTATAACCCATCAATAGGG - Intronic
984780854 4:183524676-183524698 CCTCATATAACCATTCCCTAGGG + Intergenic
988407720 5:30845362-30845384 CCTTATATCACTCATCAATAGGG + Intergenic
988415634 5:30943601-30943623 ACTGATATAACCTCTCATTATGG - Intergenic
990779946 5:59349185-59349207 GCTTATATAACCCAGCCTTACGG + Intronic
991987088 5:72299998-72300020 CCTCATATTTCCTACCATTATGG + Intronic
992506470 5:77392040-77392062 ACTCATTTATCCCATAATTATGG - Intronic
995480146 5:112585205-112585227 CTTCATATAACCCAAAATAAAGG - Intergenic
1000426385 5:161095931-161095953 CCTCATACAACCCTTAATGAGGG + Intergenic
1001100685 5:168811308-168811330 CCTCATAAAACCCATGATTTAGG + Intronic
1004879551 6:19994037-19994059 CCACACAAAACCAATCATTAAGG - Intergenic
1016332840 6:142971803-142971825 CCCTATTTAACTCATCATTATGG + Intergenic
1018225568 6:161625612-161625634 CTGCATATAACCCATCGTTGAGG + Intronic
1021674538 7:23066999-23067021 CATCAAATTACCTATCATTATGG - Intergenic
1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG + Intronic
1026348830 7:69498150-69498172 CCCCATATAACCAATGTTTATGG - Intergenic
1038594346 8:28872936-28872958 CCTCAAATAATCAGTCATTATGG - Intronic
1039417646 8:37409401-37409423 CCTCATATTAACCATCATGGAGG - Intergenic
1043789528 8:84446885-84446907 TCTCATATTACCTATCAGTATGG - Intronic
1046110123 8:109712668-109712690 CATCAGGTAAACCATCATTATGG - Intergenic
1055982061 9:82013966-82013988 CCTAAAATAATCAATCATTAAGG - Intergenic
1056870253 9:90270791-90270813 CCTCAGATAACCAACCGTTAGGG - Intergenic
1059134316 9:111790307-111790329 CCTAATATAATCCATCAGAAGGG + Intronic
1188798794 X:34500816-34500838 TCTCAAAAAAGCCATCATTAAGG + Intergenic
1189028210 X:37421399-37421421 CATCATATAATCCTTGATTAAGG + Intronic
1200479986 Y:3689876-3689898 CACCATATGGCCCATCATTATGG - Intergenic
1201219275 Y:11750982-11751004 CCTAATATAACCCTTCATATAGG + Intergenic