ID: 1075933910

View in Genome Browser
Species Human (GRCh38)
Location 10:126323442-126323464
Sequence CAGCCTCCAAATGATTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075933908_1075933910 23 Left 1075933908 10:126323396-126323418 CCACATAGCACTAAAGTGAAGAA 0: 1
1: 0
2: 0
3: 13
4: 687
Right 1075933910 10:126323442-126323464 CAGCCTCCAAATGATTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075933910 Original CRISPR CAGCCTCCAAATGATTTTAA AGG Intronic
No off target data available for this crispr