ID: 1075933917

View in Genome Browser
Species Human (GRCh38)
Location 10:126323468-126323490
Sequence CAGAGTTGCCAAAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075933911_1075933917 0 Left 1075933911 10:126323445-126323467 CCTCCAAATGATTTTAAAGGACC 0: 1
1: 0
2: 0
3: 14
4: 166
Right 1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG No data
1075933912_1075933917 -3 Left 1075933912 10:126323448-126323470 CCAAATGATTTTAAAGGACCCAG 0: 1
1: 0
2: 1
3: 15
4: 148
Right 1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075933917 Original CRISPR CAGAGTTGCCAAAAGGAGGT AGG Intronic
No off target data available for this crispr