ID: 1075934273

View in Genome Browser
Species Human (GRCh38)
Location 10:126326379-126326401
Sequence ACAGGGGGTCCTTTCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075934265_1075934273 21 Left 1075934265 10:126326335-126326357 CCAGTATACATAGTAAGTCAATG 0: 1
1: 0
2: 0
3: 9
4: 91
Right 1075934273 10:126326379-126326401 ACAGGGGGTCCTTTCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075934273 Original CRISPR ACAGGGGGTCCTTTCTCTTT GGG Intronic
No off target data available for this crispr