ID: 1075936027

View in Genome Browser
Species Human (GRCh38)
Location 10:126342097-126342119
Sequence CACAGTCATCCCTGCAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 194}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075936027_1075936036 -1 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936036 10:126342119-126342141 GGCTTGGGCAGGATGCAGGTGGG No data
1075936027_1075936041 16 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936041 10:126342136-126342158 GGTGGGGAATAGGGTGAGATGGG No data
1075936027_1075936044 27 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936044 10:126342147-126342169 GGGTGAGATGGGGAATAAGGTGG No data
1075936027_1075936035 -2 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936035 10:126342118-126342140 TGGCTTGGGCAGGATGCAGGTGG No data
1075936027_1075936034 -5 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936034 10:126342115-126342137 CTGTGGCTTGGGCAGGATGCAGG No data
1075936027_1075936045 28 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936045 10:126342148-126342170 GGTGAGATGGGGAATAAGGTGGG No data
1075936027_1075936039 7 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936039 10:126342127-126342149 CAGGATGCAGGTGGGGAATAGGG No data
1075936027_1075936043 24 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936043 10:126342144-126342166 ATAGGGTGAGATGGGGAATAAGG No data
1075936027_1075936038 6 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936038 10:126342126-126342148 GCAGGATGCAGGTGGGGAATAGG No data
1075936027_1075936042 17 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936042 10:126342137-126342159 GTGGGGAATAGGGTGAGATGGGG No data
1075936027_1075936040 15 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936040 10:126342135-126342157 AGGTGGGGAATAGGGTGAGATGG No data
1075936027_1075936037 0 Left 1075936027 10:126342097-126342119 CCCCACTTGCAGGGATGACTGTG 0: 1
1: 0
2: 1
3: 12
4: 194
Right 1075936037 10:126342120-126342142 GCTTGGGCAGGATGCAGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075936027 Original CRISPR CACAGTCATCCCTGCAAGTG GGG (reversed) Intronic
904888601 1:33761012-33761034 GTCAGTCATTCCTGCAAATGGGG - Intronic
905996566 1:42386372-42386394 CAGTGTCCTCCCTGCTAGTGAGG - Intronic
908985196 1:70009476-70009498 CATAACCATCCCTGCAAATGAGG + Intronic
911321319 1:96416584-96416606 CATAGACATCCCTGCCAGTTAGG + Intergenic
912094553 1:106121792-106121814 CACAGTCATGCCTGAAAGCCTGG - Intergenic
912100215 1:106194325-106194347 CATAGGCATCCCTGAAAGGGAGG + Intergenic
913076901 1:115347875-115347897 CAAAGTCATCTCTGCACATGGGG - Intergenic
916265536 1:162886862-162886884 AACAGTCATCCCTGACAGGGTGG - Intergenic
919727507 1:200893823-200893845 CTCTGTCATCCCTGCACTTGGGG + Intronic
919818527 1:201457669-201457691 CACAGTGATCCTAGGAAGTGGGG + Intergenic
921943511 1:220869131-220869153 AAAAGTCAGTCCTGCAAGTGAGG + Intergenic
923013916 1:230110983-230111005 CACACACATTCCTGCAAGTCAGG - Intronic
1063025509 10:2174872-2174894 CACCTTCATCCTTGCAAGTCTGG - Intergenic
1063718408 10:8553502-8553524 CACAGTGATTCCTCCAAGAGTGG + Intergenic
1067086176 10:43239759-43239781 TACAGACATCCTTGTAAGTGGGG - Intronic
1069839901 10:71333243-71333265 CACAGTCCTCCCAGGCAGTGAGG - Intronic
1070247852 10:74748809-74748831 CAGAATAATCCCTGGAAGTGGGG - Intergenic
1070870723 10:79749504-79749526 CACTGTCATCCCTGAAAGGAAGG + Intergenic
1072109240 10:92302220-92302242 TACAGTCAGCCCTCCAACTGAGG - Intronic
1073589143 10:104739593-104739615 CACAGTAGTCCCTGCAACAGGGG + Intronic
1073876045 10:107922119-107922141 CACTGGCATCCCTGAAAGGGAGG + Intergenic
1074570029 10:114615924-114615946 CAAACTCCTCCCTGCAAGTCAGG - Intronic
1075936027 10:126342097-126342119 CACAGTCATCCCTGCAAGTGGGG - Intronic
1076359398 10:129876481-129876503 CACAGTCATGTCTGCAGCTGGGG - Intronic
1077076223 11:703413-703435 CACACTCAGCCCTGTCAGTGGGG + Intronic
1077111622 11:864560-864582 CACAGTGCTCCCTGGGAGTGAGG - Intronic
1077324698 11:1958700-1958722 CACAGGCCTCCCTGCCAGGGAGG + Intronic
1077563530 11:3281358-3281380 CACCCTCTTCCCTGCAGGTGAGG - Intergenic
1077569421 11:3327173-3327195 CACCCTCTTCCCTGCAGGTGAGG - Intergenic
1080713251 11:34771050-34771072 CATTGGCATCCCTGAAAGTGAGG - Intergenic
1081788851 11:45768419-45768441 CACAGTGAACCATGCAAGGGAGG + Intergenic
1083942395 11:65903424-65903446 CACAGCCATCGCTGGAAGTTTGG + Intergenic
1085772479 11:79337778-79337800 CACAGCCATCCTTGCCAGAGTGG + Intronic
1086415026 11:86580176-86580198 CACTGGAATTCCTGCAAGTGTGG + Intronic
1086793525 11:91071364-91071386 CACAGTCTTCCATGCATGAGTGG - Intergenic
1086850324 11:91800184-91800206 CACAGTGATGCCTGAAAGTTTGG - Intergenic
1087791843 11:102414224-102414246 CACTGGCATCCCTGAAAGAGAGG + Intronic
1089593357 11:119559435-119559457 CACAGACATCCCTCCAAGGTGGG + Intergenic
1202807677 11_KI270721v1_random:13877-13899 CACAGGCCTCCCTGCCAGGGAGG + Intergenic
1091865791 12:3835024-3835046 CACTGTCATCCCTGACAGTCTGG + Intronic
1092251291 12:6899081-6899103 CACAGTAATCCCAGCACTTGGGG - Intronic
1092881571 12:12891342-12891364 CACAGTCACCCCTGGAAGCTGGG - Exonic
1093477490 12:19572352-19572374 CACTGGCATCCCTGAAAGAGAGG - Intronic
1102458803 12:113087526-113087548 CAGAGACAGCCCTGAAAGTGGGG + Intronic
1104831039 12:131751600-131751622 CAACGTCATCCCTGGAAGGGGGG - Intronic
1106689826 13:32103120-32103142 CACAGCCAGCCCTGCAACGGTGG + Intronic
1107750124 13:43556358-43556380 CACTATCATCTCTGTAAGTGAGG - Intronic
1108752118 13:53458467-53458489 AACAGTTATCCCTGAAAATGGGG - Intergenic
1109317225 13:60764576-60764598 CACTGTCATCCCTGAAAGGGAGG - Intergenic
1117026149 14:51622106-51622128 CACAGGGATCTGTGCAAGTGAGG - Intronic
1117316318 14:54574439-54574461 CACAGAGTTCCCTGCATGTGTGG - Intronic
1118102418 14:62621788-62621810 AACAATCATCCCTGGAATTGGGG - Intergenic
1119250294 14:73146968-73146990 CACAGTCATCCCTGTAAATAAGG + Intronic
1119438926 14:74615386-74615408 CACAGTAATCCCATCAAGTGGGG + Intergenic
1120854377 14:89200250-89200272 CACAGTGAACCCTGCAAATTCGG + Intronic
1124633076 15:31348200-31348222 CACAGTCATCCTGACAAGAGTGG - Intronic
1128491407 15:68149289-68149311 CAATGTCAGCCCTGCCAGTGTGG - Intronic
1129194128 15:73954165-73954187 CAGAGTCCTCCCAGCATGTGAGG - Intergenic
1135969049 16:27059007-27059029 CACTGACCACCCTGCAAGTGAGG + Intergenic
1140632784 16:76873755-76873777 CACAGTCATCTCCAGAAGTGTGG + Intergenic
1141805883 16:86341234-86341256 CACAGTCATCCCTGATCATGAGG + Intergenic
1145737310 17:27241877-27241899 CACGGTCAGTCCAGCAAGTGAGG - Intergenic
1146518894 17:33510966-33510988 TACAGTCATCTAAGCAAGTGTGG - Intronic
1146662348 17:34673230-34673252 CTCAGTGCTCCATGCAAGTGTGG - Intergenic
1146910911 17:36647880-36647902 CACAGACACCCCTGCAGGTGTGG + Intergenic
1147541254 17:41361918-41361940 GACAGTAATCCCAGCATGTGTGG + Intergenic
1148702234 17:49595589-49595611 AACAGACATCCATGGAAGTGAGG - Intergenic
1148808827 17:50277939-50277961 TACAGACCTGCCTGCAAGTGTGG - Intronic
1149307068 17:55358341-55358363 CATAGTCATCCCTGAAAGTCTGG + Intergenic
1153020456 18:624018-624040 CTCTGGCTTCCCTGCAAGTGTGG - Intronic
1153225702 18:2898201-2898223 CACAGGTATCCCCACAAGTGGGG + Intronic
1155260512 18:24037935-24037957 CAGAGACTTCCCTGCAGGTGAGG + Intronic
1155769101 18:29674058-29674080 CACTGTCATCCCTGAAAGAGAGG + Intergenic
1160042681 18:75360041-75360063 CAAGGTCATGCCAGCAAGTGTGG - Intergenic
1164099691 19:22043837-22043859 CACAATCTTCCCTGAATGTGGGG + Intergenic
1164254993 19:23520233-23520255 CACAATCATCCCTGTAAGCAGGG + Intergenic
1165720940 19:38079369-38079391 CACAGACATCCCTGCCATTCTGG + Intronic
1167496732 19:49823821-49823843 CACAGTCATTCCTTGTAGTGGGG + Intronic
926162974 2:10501377-10501399 CCCAGGCAACCCTTCAAGTGGGG - Intergenic
928876997 2:36051752-36051774 CACTGACATCCCTGAAAGAGAGG - Intergenic
929324695 2:40595043-40595065 AGCAGTCATCCCTGAAAGTTAGG - Intronic
930229584 2:48829247-48829269 CACTGGCATCCCTGAAAGGGAGG + Intergenic
930583507 2:53242288-53242310 CACATCCATGCCTGCAAGTCTGG + Intergenic
931441987 2:62296545-62296567 CCCAGGCTTCCCTGCAAGGGCGG + Intergenic
931543500 2:63354967-63354989 CACTGACATCCCTGAAAGGGAGG + Intronic
931838943 2:66128675-66128697 CACAGTCATTCTTCCCAGTGGGG - Intergenic
932371990 2:71198008-71198030 CACTGGCATCCCTGAAAGGGAGG - Intronic
933693255 2:85195983-85196005 CACAGCCATCCCAGCAAGACTGG - Intronic
934622716 2:95825222-95825244 CACTGGCATCCCTGAAAGGGAGG - Intergenic
934811062 2:97276881-97276903 CACTGGCATCCCTGAAAGGGAGG + Intergenic
934826630 2:97431058-97431080 CACTGGCATCCCTGAAAGGGAGG - Intergenic
935452148 2:103222105-103222127 CACATTCATCCCGGCAGGTTGGG + Intergenic
936144129 2:109967814-109967836 CCCAGGAATCCCTGCCAGTGTGG + Intergenic
936180811 2:110265775-110265797 CCCAGGAATCCCTGCCAGTGTGG + Intergenic
936200558 2:110403655-110403677 CCCAGGAATCCCTGCCAGTGTGG - Intronic
937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG + Intronic
945562290 2:211353895-211353917 CACAGTGATCCTTTCAAGTCTGG - Intergenic
945666648 2:212752046-212752068 CAAAGTCATCCATGAAAGAGGGG - Intergenic
946218961 2:218210112-218210134 AACAGTAATCCCTGAAACTGGGG - Intergenic
947517993 2:230823709-230823731 GACAGTCATTCCTGCATTTGGGG - Intergenic
948770769 2:240250366-240250388 TACAGTCATCCCTGCAAGGGTGG + Intergenic
1172032682 20:31992907-31992929 CACAGTTCTCCCTGGATGTGGGG - Intronic
1174935948 20:54868783-54868805 CACCATCATCACTTCAAGTGTGG - Intergenic
1175379765 20:58554748-58554770 CAGAGGCTGCCCTGCAAGTGTGG + Intergenic
1175642995 20:60647112-60647134 CACAATCATAGCTGCAAGGGAGG + Intergenic
1175773747 20:61640350-61640372 CACATTCATCTCTGCAGCTGGGG - Intronic
1175837877 20:62007998-62008020 CAAAGCCAGCACTGCAAGTGCGG + Intronic
1175911073 20:62405877-62405899 CACAGTCACTCCTGGAGGTGAGG + Intronic
1180188239 21:46150897-46150919 CTCAGTCACCCCGACAAGTGCGG - Intronic
1180188838 21:46153255-46153277 CACCGTCCTCCCAGCCAGTGTGG + Intronic
1180716291 22:17874582-17874604 GACAAGCATCCCTGCAAGAGAGG + Intronic
1180858471 22:19063054-19063076 CGCAGCCCTCCCTGCAACTGGGG + Intronic
1181307961 22:21927619-21927641 CACAGCCATCCCTGGTGGTGGGG - Intronic
1181456272 22:23061803-23061825 CACAGTGATCACTGAAGGTGAGG - Exonic
1182557973 22:31139374-31139396 CACAGCCAGCCCTGAAAGGGAGG + Intronic
1182724663 22:32434626-32434648 CTCAGTAATCCCTAAAAGTGAGG - Intronic
1183105019 22:35609424-35609446 AACAGACAACCCTGCATGTGAGG - Intronic
1183810215 22:40250013-40250035 CACAATCATCCCTGGAAGGAAGG - Intronic
1184456088 22:44610093-44610115 CAAAGCCCTCCCTGCAGGTGAGG + Intergenic
1184976649 22:48066989-48067011 CACAGGCATCCTTACAAGAGGGG + Intergenic
1185097767 22:48821060-48821082 CACAGCCAGCCCTGCATGTGTGG - Intronic
950075875 3:10186677-10186699 CACAGTCTTCCCTGCTGCTGAGG + Intronic
950747295 3:15100524-15100546 CATAGTCCTGCCTGTAAGTGTGG - Intergenic
951408486 3:22330693-22330715 CACAGAAATCCCTGCTTGTGTGG - Intronic
952405266 3:32999533-32999555 CACAGTCCACCCGGCATGTGAGG - Intronic
952543120 3:34388858-34388880 GACAGTCAGCCCAACAAGTGTGG - Intergenic
954579391 3:51695035-51695057 CACAGCAGTCCCTGCAAGTGGGG - Intronic
956449352 3:69358067-69358089 CATAGTCAACTCTGCAATTGAGG + Intronic
957428936 3:80076593-80076615 CCCAGTCAGCCCTGGATGTGGGG - Intergenic
960924710 3:122783023-122783045 CACAGTCATCATTCTAAGTGAGG + Intronic
961320357 3:126068854-126068876 TACAGACAGCCCTCCAAGTGGGG - Intronic
961563218 3:127745841-127745863 AGCTGCCATCCCTGCAAGTGGGG + Intronic
962041722 3:131714282-131714304 CACAGTGGTCCCTGAAAGAGTGG - Intronic
962997569 3:140646564-140646586 CACTGGCATCCCTGAAAGAGAGG - Intergenic
963508734 3:146221481-146221503 CACAGTAATTGCTGCAAGGGAGG + Intronic
963740669 3:149077419-149077441 TACAGTCAGCCTTGCAAGTGGGG - Intronic
966152496 3:176879334-176879356 CACTGGCATCCCTGAAAGGGAGG + Intergenic
966519404 3:180856257-180856279 TACAGTCATACCCTCAAGTGGGG + Intronic
968611307 4:1558363-1558385 CACAGTCATATTTGCATGTGTGG + Intergenic
969337017 4:6517046-6517068 CACAGTTATTCCTGGGAGTGTGG - Intronic
973574687 4:52274974-52274996 CACTGGCATCCCTGAAAGGGAGG + Intergenic
976468002 4:85393397-85393419 CACAGTCATCCTTGCATGAAGGG - Intergenic
977405009 4:96586957-96586979 CACAGTCATACCTGCAAGACAGG + Intergenic
977482380 4:97594521-97594543 CACTGGCATCCCTGGAAGAGAGG + Intronic
979728790 4:123996609-123996631 CAGAGTCATGTCTGCAAGTTAGG - Intergenic
979886906 4:126039111-126039133 CACAGATATTCCTGCAAGAGAGG - Intergenic
980576368 4:134687876-134687898 CACATACATACCTGCTAGTGGGG + Intergenic
980816230 4:137950075-137950097 CACTGGCATCCCTGAAAGAGAGG - Intergenic
981291859 4:143085809-143085831 CAGAGTTATTCCTGGAAGTGGGG - Intergenic
981748446 4:148072209-148072231 CACAGTCAGCCCTGGGGGTGGGG + Exonic
982066865 4:151662093-151662115 AACAGTCATCCCAGCATGAGAGG + Intronic
987001991 5:13669033-13669055 CACACTCATCCCTACAGGTCTGG + Intergenic
987211969 5:15692795-15692817 CTCAGCCATCCAAGCAAGTGAGG + Intronic
988128627 5:27074843-27074865 CACTGGCATCCCTGAAAATGAGG + Intronic
988258275 5:28849377-28849399 AACACTCATCCCTGCCACTGTGG - Intergenic
990659924 5:58001958-58001980 CACAGTCATCCCTGCACTACAGG + Intergenic
993739088 5:91515060-91515082 CACAGTCATGCAGGCATGTGAGG + Intergenic
994473279 5:100237223-100237245 CACTGGCATCCCTGAAAGGGAGG - Intergenic
996305640 5:122044080-122044102 CACATTCTCACCTGCAAGTGGGG - Intronic
1002832394 6:834485-834507 CACAGGGAACCCTGCAAATGAGG + Intergenic
1003242349 6:4355599-4355621 CACAGTCTTCCCAGAATGTGTGG + Intergenic
1004285072 6:14314140-14314162 CACAAGCAGCCCTGCAGGTGAGG - Intergenic
1005800026 6:29411301-29411323 CACTGGTATCCCTGCAAGAGAGG + Intronic
1006800073 6:36754048-36754070 CACAGGCCTCCTTCCAAGTGTGG + Intronic
1010958124 6:82114678-82114700 CACACTCATCTCTGTAAATGAGG + Intergenic
1013283355 6:108659637-108659659 CACTGTCATCCTTGCAATTAGGG + Intronic
1014869268 6:126571606-126571628 CACAGTCATTTCTTAAAGTGGGG - Intergenic
1017916796 6:158837348-158837370 CACTGTCATCCCTGCCTCTGTGG + Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1018847296 6:167564622-167564644 CTCAGTCCTCCCTGCAAGGGTGG - Intergenic
1019127415 6:169849964-169849986 TACTGTCACCCCTGCAACTGAGG - Intergenic
1019498932 7:1354853-1354875 CACAGTCCTCTGAGCAAGTGGGG + Intergenic
1022007105 7:26276341-26276363 AACAGACTTCCCTGCCAGTGTGG + Intergenic
1023388270 7:39682345-39682367 CCCAGTAATCCATGCAAGAGAGG - Intronic
1023470024 7:40507603-40507625 CACACTCATCCATGGAAGTCTGG - Intronic
1023847649 7:44131688-44131710 CCTAGTCATACCTGCCAGTGAGG + Intergenic
1023886221 7:44358954-44358976 CACTGGCATCCCTGAAAGGGAGG - Intergenic
1024524720 7:50338150-50338172 CATAGTCATCACTGCAAGCATGG - Intronic
1024852902 7:53742048-53742070 CACTGGCATCCCTGAAAGAGAGG + Intergenic
1026612677 7:71874541-71874563 CCCAGTCCACGCTGCAAGTGTGG - Intronic
1028484902 7:91347156-91347178 GAAAGTCATTCCTGCAAGTCAGG + Intergenic
1030200748 7:106901171-106901193 CACTGGCATCCCTGAAAGGGAGG - Intronic
1035206318 7:157295988-157296010 CACCGTCCTCCCTGCAGCTGGGG + Intergenic
1035206332 7:157296032-157296054 CACCGTCCTCCCTGCAGCTGGGG + Intergenic
1035682801 8:1500665-1500687 CACTGTCTTCCCTCCATGTGTGG - Intergenic
1036012313 8:4740132-4740154 CACAGTCATCCCTGCAGGGAGGG - Intronic
1036175510 8:6534142-6534164 CACAGTCAGCCCTCCATCTGTGG + Intronic
1037756729 8:21715083-21715105 CACAGTGAGCCCTGGAGGTGTGG - Intronic
1038498030 8:28019781-28019803 CACAGTCACCCCTGAAAGAAGGG - Intergenic
1038805736 8:30789610-30789632 CACACTCATCCCTGACAGTCTGG - Intronic
1038988201 8:32836544-32836566 CACTGCCATCCCTGAATGTGTGG - Intergenic
1042401355 8:68351576-68351598 CACTGGCATCCCTGAAAGGGAGG - Intronic
1044919949 8:97158358-97158380 CACAGTCTTCCCTCCAAGGCAGG - Intergenic
1046967341 8:120182357-120182379 AACAGTCAGCCCTGCAGGTATGG - Intronic
1048170604 8:132102644-132102666 CAGAGTCCTCCATGCAGGTGAGG + Intronic
1049494773 8:142924528-142924550 CACAGGAGTCCCTGAAAGTGGGG - Intergenic
1050650973 9:7776288-7776310 AACAGTCCACCCTGCAAGCGGGG + Intergenic
1054717143 9:68567516-68567538 TGCAGTCATCACTGCCAGTGGGG + Intergenic
1055131464 9:72779786-72779808 CACTGACATCCCTGAAAGAGAGG + Intronic
1055296954 9:74843308-74843330 CAAAGTCATCCATGAAAGTTGGG + Intronic
1057194164 9:93107517-93107539 CACAGCCATCCCAGCCTGTGTGG - Intronic
1060407277 9:123379132-123379154 GTCAGTCAGTCCTGCAAGTGGGG + Intronic
1061697427 9:132387435-132387457 CCCAGTCTTCCCTGCTAGAGAGG - Intronic
1193827688 X:86246192-86246214 CATTGGCATCCCTGAAAGTGAGG + Intronic
1194181580 X:90716594-90716616 CAGATTCAGGCCTGCAAGTGTGG + Intergenic
1197446335 X:126554855-126554877 AACAGGCATTGCTGCAAGTGAGG + Intergenic
1200528205 Y:4298508-4298530 CAGATTCAGGCCTGCAAGTGTGG + Intergenic