ID: 1075945632

View in Genome Browser
Species Human (GRCh38)
Location 10:126430699-126430721
Sequence CTCATTCAGCAGAAGCAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075945627_1075945632 10 Left 1075945627 10:126430666-126430688 CCGTGCTTCCTAAAACACCTGGG 0: 1
1: 0
2: 1
3: 23
4: 334
Right 1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG No data
1075945630_1075945632 -7 Left 1075945630 10:126430683-126430705 CCTGGGCAGTAACCTGCTCATTC 0: 1
1: 0
2: 2
3: 16
4: 135
Right 1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG No data
1075945629_1075945632 2 Left 1075945629 10:126430674-126430696 CCTAAAACACCTGGGCAGTAACC No data
Right 1075945632 10:126430699-126430721 CTCATTCAGCAGAAGCAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075945632 Original CRISPR CTCATTCAGCAGAAGCAGAC AGG Intronic
No off target data available for this crispr