ID: 1075948530

View in Genome Browser
Species Human (GRCh38)
Location 10:126458029-126458051
Sequence CTGTCTAAAGACCTCGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075948530_1075948538 8 Left 1075948530 10:126458029-126458051 CCTTCCCCGAGGTCTTTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1075948538 10:126458060-126458082 GCAGAGTTCTGGTGGAGAGAAGG No data
1075948530_1075948534 -3 Left 1075948530 10:126458029-126458051 CCTTCCCCGAGGTCTTTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1075948534 10:126458049-126458071 CAGCTCCACCAGCAGAGTTCTGG No data
1075948530_1075948535 0 Left 1075948530 10:126458029-126458051 CCTTCCCCGAGGTCTTTAGACAG 0: 1
1: 0
2: 0
3: 9
4: 93
Right 1075948535 10:126458052-126458074 CTCCACCAGCAGAGTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075948530 Original CRISPR CTGTCTAAAGACCTCGGGGA AGG (reversed) Intronic
901960842 1:12825481-12825503 CTGTCTGAAGACCTCGTTAAAGG - Exonic
901975236 1:12939214-12939236 CTGTCTGAAGACCTCGTTAAAGG - Exonic
901982838 1:13050347-13050369 CTGTCTGAAGACCTCGTTAAAGG - Intronic
901986183 1:13076991-13077013 CTGTCTGAAGACCTCGTTAAAGG + Exonic
901995629 1:13149776-13149798 CTGTCTGAAGACCTCGTTAAAGG - Intergenic
901999251 1:13178571-13178593 CTGTCTGAAGACCTCGTTAAAGG + Intergenic
902009939 1:13262550-13262572 CTGTCTGAAGACCTCGTTAAAGG + Exonic
902837798 1:19058140-19058162 CTGTCTGGAGACCTGAGGGAAGG + Intergenic
903262102 1:22136909-22136931 CTGTCTCCAGCCCTTGGGGAAGG + Intronic
905033169 1:34900991-34901013 CTGGCTGAGGACCTGGGGGAGGG + Intronic
906610084 1:47195381-47195403 CTGTCCACAGCCCTCTGGGAAGG - Intergenic
907294753 1:53443312-53443334 ATGTCTAAATCCCTGGGGGAGGG + Intergenic
909091387 1:71230245-71230267 CTTTCTGAAGACCTTGGAGAAGG - Intergenic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
911568104 1:99488642-99488664 ATTTCTAAAGATGTCGGGGAAGG + Intergenic
912968714 1:114260334-114260356 CTGTCTAAAGATCTCAGGGCTGG - Intergenic
914429159 1:147604240-147604262 CTGTGGATAGACCTGGGGGACGG - Intronic
917779777 1:178381176-178381198 CTATCTAAAGATCTCTAGGAAGG + Intronic
919832190 1:201549708-201549730 CTGTCTTAAGACCTGGGTGCCGG + Intergenic
920503087 1:206497671-206497693 CACTCTAAAGGCCTGGGGGAAGG + Exonic
922021687 1:221711429-221711451 ATGTCCAAAGACCAGGGGGAGGG + Intronic
1070681683 10:78453383-78453405 CTGTCTAACTACCTGGGGGAAGG - Intergenic
1071051694 10:81458461-81458483 CTGTCTACAGAGCTAAGGGAAGG + Intergenic
1074157210 10:110809602-110809624 CCGTCTAATGACCTCTGGGAAGG + Intronic
1074216022 10:111384469-111384491 CTATGTAAAGCCCTGGGGGAGGG + Intergenic
1075725561 10:124609031-124609053 CTGTCCAGAGCCCTGGGGGACGG + Intronic
1075948530 10:126458029-126458051 CTGTCTAAAGACCTCGGGGAAGG - Intronic
1079669422 11:23148532-23148554 CTGTCTGAAGACATCTGAGAAGG - Intergenic
1091286305 11:134410514-134410536 CTGTCTGAAGACCCTGGGAAAGG + Intronic
1096184205 12:49567708-49567730 CTGTCTCAAGAACTCGGGGTAGG + Intronic
1098698627 12:73593018-73593040 CTGTCAAAAGAGCTCAAGGAAGG - Intergenic
1103101063 12:118176250-118176272 ATGTGGAAAGACCTTGGGGAAGG + Intronic
1104078882 12:125413030-125413052 CTGTGTAAAGACCTACAGGAAGG + Intronic
1110489045 13:76080877-76080899 CTGTCTTAATACCTAGGTGAGGG + Intergenic
1117406534 14:55409617-55409639 CTGTCTAAATACCACTGCGAAGG + Intronic
1120305893 14:82770341-82770363 CTGTCTAAAGACCAAGGGAGGGG - Intergenic
1128218911 15:65953955-65953977 CTCCCTAAAGACCCCGGGCAGGG + Intronic
1128542230 15:68544088-68544110 CTGTCTACAGAGCTTGGGGAAGG - Intergenic
1129210202 15:74063966-74063988 CTCTCTAGAGTCCTCGGAGAGGG + Intergenic
1129403820 15:75301436-75301458 CTCTCTAGAGTCCTCGGAGAGGG - Intergenic
1133741501 16:8655212-8655234 CTGTCTTAAGACCTCTGCTAAGG + Intergenic
1141735807 16:85851880-85851902 CTTTCTAAAGGCCTTGGGAAAGG - Intergenic
1143373542 17:6454753-6454775 CTGTCCACAGCCCTCGGGGGTGG - Exonic
1148130939 17:45262276-45262298 CTCTCCGAAGACCTCGGGGGTGG + Intergenic
1148838537 17:50479518-50479540 CTGTGGAAAGACCTCGGGATAGG + Intronic
1148880135 17:50719445-50719467 CTGTCTAGAGGCCGCGGGGACGG - Intergenic
1151319903 17:73346789-73346811 CTCTCCAAAGACCTGGGGGAAGG + Intronic
1152472913 17:80500215-80500237 GTGTCCTCAGACCTCGGGGAAGG - Intergenic
1155806631 18:30178341-30178363 CTGCCTAAGGACATAGGGGAAGG + Intergenic
1159960864 18:74555006-74555028 CTCTCTCAAGGTCTCGGGGATGG + Intronic
1161069799 19:2254348-2254370 GTGTCTAAAGCCCACGGGAAGGG - Intronic
1165818243 19:38656852-38656874 CTCTCAAAAGACATCAGGGAGGG - Intronic
1167690223 19:50980538-50980560 GTGTGCAAAGACCTGGGGGACGG + Intronic
926633384 2:15157547-15157569 GTATCTTAAGACCCCGGGGAGGG - Intergenic
926701896 2:15809571-15809593 CTCCCCAAAGTCCTCGGGGAAGG - Intergenic
927700289 2:25263863-25263885 CTGCCTAAGGGCCTCAGGGAAGG - Intronic
931430630 2:62206138-62206160 GTGTCTAGAGGCCTCCGGGATGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934792317 2:97071774-97071796 CTTTCTGAAGACCTCTGGGGAGG + Intergenic
934814301 2:97311935-97311957 CTTTCTGAAGACCTCTGGGGAGG - Intergenic
934823393 2:97396548-97396570 CTTTCTGAAGACCTCTGGGGAGG + Intergenic
936060938 2:109295411-109295433 GTGTCTAAAGAACTCAGGGCGGG + Intronic
938231951 2:129669037-129669059 CTGCCTCTAGACCACGGGGATGG + Intergenic
940277955 2:151959032-151959054 GAGTCTAAGGACCTCGAGGAAGG + Intronic
945017967 2:205539750-205539772 CTGTGCAATGACCTGGGGGAGGG - Intronic
945630118 2:212264214-212264236 CTGTCTAAATACATTGGGTATGG - Intronic
1170026160 20:11891255-11891277 CAGCCGAAAGACCGCGGGGAGGG + Intronic
1180559278 22:16602153-16602175 CAGACAAAAGACCTCGGGGCCGG + Intergenic
1181033253 22:20158161-20158183 CTGTCTCCAGGCCCCGGGGAGGG - Intergenic
1182023924 22:27102603-27102625 CTGCCTAAGGACCTGGGGCATGG - Intergenic
952242951 3:31552712-31552734 CTGTCCAAAGGACTCGTGGATGG - Intronic
954202551 3:49032710-49032732 CTGTCGCAAGACCTTGGAGAAGG + Exonic
961133695 3:124491313-124491335 CTGTCTACAGACCTCAGAGCTGG + Exonic
962168975 3:133080543-133080565 CTGACTAAAGAGCTCTGGGAAGG - Intronic
974101991 4:57427354-57427376 GTGTCAAATTACCTCGGGGATGG + Intergenic
974873399 4:67672772-67672794 CTATATAAAGATCTGGGGGAAGG - Intronic
975022055 4:69502322-69502344 CTGTGTTAATACCTCGGTGATGG - Intronic
975977222 4:80113196-80113218 ATGTTTAAAGACCTCAAGGAAGG - Intronic
976131412 4:81888445-81888467 TGGTCTCAAGACCTAGGGGAAGG + Intronic
976886130 4:89986699-89986721 CAGTCTAAAGACCTGGAGGCAGG - Intergenic
979604220 4:122620116-122620138 CTTTCAAAAGACCTCACGGAAGG + Intronic
985814619 5:2117392-2117414 CTGTCTGCAAACCTGGGGGAAGG - Intergenic
992256874 5:74929958-74929980 CTGTATAAAGTCCTCTGGGCAGG - Intergenic
995865298 5:116683942-116683964 CTGTCTAAAGTGTTAGGGGAGGG - Intergenic
997743434 5:136278041-136278063 CTGTCCAAGGACCTGGGTGAGGG + Intronic
998215387 5:140234846-140234868 CGGTGTAAAGACCTCGAGGGAGG - Intronic
999032602 5:148310848-148310870 ATGTATGAAGACCTGGGGGAAGG - Intergenic
1000568150 5:162877068-162877090 TTGTCTTAAGACCTGGGAGAAGG - Intergenic
1001550482 5:172598740-172598762 CTGTCTCAAGACTTTTGGGAGGG + Intergenic
1017023958 6:150165436-150165458 CTGGCTAAAGTCCTTGGGGAAGG + Intronic
1021814797 7:24436569-24436591 CTGCTTAAAGACCTAGGGAAGGG - Intergenic
1021928314 7:25554270-25554292 CTGGATAAAGACCTCTGTGAGGG - Intergenic
1023091756 7:36624426-36624448 CTGTCTTATGAACTCTGGGATGG + Intronic
1027363270 7:77431208-77431230 CAGTCTCACGACCTCTGGGATGG - Intergenic
1034617967 7:152435670-152435692 CAGACAAAAGACCTCGGGGCCGG - Exonic
1046101092 8:109614982-109615004 ATGTCACAGGACCTCGGGGAAGG - Intronic
1048468039 8:134683760-134683782 CTGTCTCCAGACCTCCAGGATGG - Intronic
1049685635 8:143938197-143938219 CTGTATGAAGACCTCCGCGATGG - Exonic
1056316880 9:85398697-85398719 CTGTGCAAAGACCTCATGGAGGG - Intergenic
1059911114 9:119045267-119045289 CTGTCTACAGACATCGGGAGAGG + Intergenic
1186912840 X:14187785-14187807 CTGTCAAGAGAACACGGGGAGGG - Intergenic
1195629602 X:107041135-107041157 CTGTCTAAGTACCTAAGGGATGG + Intergenic
1195994648 X:110719739-110719761 CTGTCTAATGTCCTAGGGAAAGG - Intronic