ID: 1075948841

View in Genome Browser
Species Human (GRCh38)
Location 10:126460258-126460280
Sequence CGTGCTAGGCTGTGAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075948837_1075948841 16 Left 1075948837 10:126460219-126460241 CCGATGGGCTTGAGCAACAGTGA 0: 1
1: 0
2: 0
3: 12
4: 133
Right 1075948841 10:126460258-126460280 CGTGCTAGGCTGTGAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075948841 Original CRISPR CGTGCTAGGCTGTGAGCTCC AGG Intronic
No off target data available for this crispr