ID: 1075948914

View in Genome Browser
Species Human (GRCh38)
Location 10:126460706-126460728
Sequence AGGGGGCCTCGGTGGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075948914_1075948931 27 Left 1075948914 10:126460706-126460728 CCCAGGTCCCACCGAGGCCCCCT 0: 1
1: 0
2: 4
3: 30
4: 264
Right 1075948931 10:126460756-126460778 TCTCCACAACTGCAACTGCAGGG No data
1075948914_1075948930 26 Left 1075948914 10:126460706-126460728 CCCAGGTCCCACCGAGGCCCCCT 0: 1
1: 0
2: 4
3: 30
4: 264
Right 1075948930 10:126460755-126460777 ATCTCCACAACTGCAACTGCAGG No data
1075948914_1075948926 -1 Left 1075948914 10:126460706-126460728 CCCAGGTCCCACCGAGGCCCCCT 0: 1
1: 0
2: 4
3: 30
4: 264
Right 1075948926 10:126460728-126460750 TGGGTACAGGAGCCAGCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075948914 Original CRISPR AGGGGGCCTCGGTGGGACCT GGG (reversed) Intronic
900191646 1:1354655-1354677 AGGAGGCCTCCCTGGGACCCGGG - Intronic
900364329 1:2304716-2304738 AGTGGGCCTGCCTGGGACCTTGG + Intronic
900528057 1:3138789-3138811 AGGGGGCCTTGGAGGGAGCCAGG + Intronic
901234716 1:7661658-7661680 AGGGGACCTGGGTGGGGCCAAGG - Intronic
901638044 1:10679529-10679551 AGGGGCCCGCGGGGGGCCCTAGG - Intronic
901668298 1:10838763-10838785 AGGGGGCCTGGCTGGGCCCTGGG + Intergenic
902368915 1:15993534-15993556 AGGGGGCTTCCATGGAACCTAGG + Intergenic
902371069 1:16007076-16007098 AGGCAGCCCAGGTGGGACCTGGG + Exonic
902551418 1:17221910-17221932 GAGGGGCCTGGGTGGGACCACGG + Intronic
902615564 1:17621737-17621759 AGTGGTCCCAGGTGGGACCTGGG + Intronic
905093048 1:35445101-35445123 AGTGTGGCTGGGTGGGACCTGGG + Intronic
908534415 1:65065711-65065733 AAGGGGCCAGGGTGGGGCCTGGG + Intergenic
910151178 1:84148989-84149011 AGTAGGTCTAGGTGGGACCTGGG - Intronic
912975256 1:114323894-114323916 ATGGGCCCTCAGTGGGCCCTGGG + Intergenic
915448591 1:155989305-155989327 AGAGGGCCTCCTTGGGGCCTGGG + Intronic
916170536 1:161998475-161998497 AGGGGGCCTGGCTGGGATTTTGG + Intronic
916313934 1:163426869-163426891 AGGGGGTATCAGTGGGACTTGGG + Intergenic
916557108 1:165902700-165902722 AGGGGGCATGGGTGGGAGCTGGG + Intronic
917793941 1:178519119-178519141 AGGCGGCCTGGGTGGGGCCCAGG + Intronic
919645514 1:200090751-200090773 AGGGGGCATCAGTGAGACCAGGG + Intronic
920964492 1:210690760-210690782 AGGGGGCCCCAGAGGGACCTAGG + Intronic
922299109 1:224280414-224280436 AGAGGGCATTGGTGGGAACTGGG - Intronic
923511866 1:234659923-234659945 AGGGGGCTTGGCTGGGACTTTGG - Intergenic
923543740 1:234908891-234908913 AGGCGGCCTCGGAGGGTGCTGGG - Intergenic
924090069 1:240492744-240492766 AGGGGGCACAGGTGGGACCCGGG + Exonic
1064059945 10:12129342-12129364 AGGAGGCCTGGGTCGGACGTGGG + Intergenic
1067028643 10:42865885-42865907 AGGGGGCGTCCATGGGGCCTTGG + Intergenic
1067192418 10:44082480-44082502 AGGGTGCCTGGCTGGGACCAGGG + Intergenic
1067214800 10:44293100-44293122 GGGGGGCCTCGGGAGGACCGCGG + Intronic
1067215135 10:44294937-44294959 AGGATGCCTCTGTGGGGCCTGGG + Intergenic
1067779545 10:49189705-49189727 AGGGGGCATCTGTGGCACCAGGG - Intergenic
1071211600 10:83348194-83348216 AGGGAGCCTCTTTGGGCCCTGGG + Intergenic
1072553480 10:96496541-96496563 AGGGGGTCTGGCTGGTACCTGGG + Intronic
1075948914 10:126460706-126460728 AGGGGGCCTCGGTGGGACCTGGG - Intronic
1076535992 10:131178099-131178121 AGGGGGCACAGGTGGGACCTTGG - Intronic
1076745726 10:132512615-132512637 AGGAGGGCTCGGGTGGACCTGGG - Intergenic
1076823774 10:132957131-132957153 AGGAGGCCTCGGAGGATCCTGGG - Intergenic
1076979131 11:195929-195951 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979159 11:196004-196026 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979190 11:196081-196103 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979227 11:196171-196193 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979242 11:196210-196232 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979287 11:196325-196347 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979302 11:196364-196386 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979318 11:196402-196424 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979334 11:196440-196462 AGGGGACATGGGGGGGACCTTGG + Intronic
1076979350 11:196478-196500 AGGGGACATGGGGGGGACCTTGG + Intronic
1076998510 11:310907-310929 GGGCGGCCGCGGTGGGAGCTGGG + Intronic
1077000233 11:318852-318874 GGGCGGCCGCGGTGGGAGCTGGG - Intergenic
1077082091 11:728732-728754 AAGGGGCCTCTGTGGGCCCCAGG + Intergenic
1081260204 11:40950128-40950150 AGGAGGGGTGGGTGGGACCTTGG - Intronic
1081998107 11:47377602-47377624 ATTGGGGCTGGGTGGGACCTGGG - Intronic
1083210825 11:61184519-61184541 AGAGGGCCATGGTGGGATCTCGG - Intergenic
1083322270 11:61855091-61855113 TGGGGGCCTGGGAGGCACCTGGG - Intronic
1083486088 11:62983860-62983882 AGGGTGTCTAGGTGGGAGCTTGG - Intronic
1083743690 11:64723688-64723710 AGGGGGACTCGGTGGGTCCATGG + Intergenic
1083798414 11:65032076-65032098 AGGGGGACTAGGAGGCACCTGGG + Intronic
1083844128 11:65321269-65321291 AGGGGGCTTGGGTGGAGCCTGGG - Exonic
1084605654 11:70170176-70170198 ATGGGGGCTCCCTGGGACCTGGG - Intronic
1085299579 11:75450333-75450355 AGGGAGGCTGGGCGGGACCTTGG - Intronic
1085702517 11:78757529-78757551 AGGGGGCCTCAGTGGGAGCTGGG + Intronic
1087624757 11:100583928-100583950 AGGGGTCCTCAGTGGGATGTTGG - Intergenic
1088653520 11:111977825-111977847 GGGGGGCCTGGGTGGGAACAGGG + Intronic
1090461841 11:126897944-126897966 AGGGGGAGTGGGTGGGAGCTTGG + Intronic
1092217401 12:6693027-6693049 AGGGGGGATAGATGGGACCTGGG + Intergenic
1093497955 12:19779359-19779381 AGGGGCCTTGGGTGGGACCTGGG + Intergenic
1094711719 12:32970636-32970658 AGGGAGCCTCGATGGCCCCTGGG + Intergenic
1096157357 12:49347925-49347947 AGGGGGCCGGGGAGGGCCCTGGG + Exonic
1096617130 12:52839738-52839760 AGGGAGGCTTGGAGGGACCTGGG - Intronic
1101948263 12:109154621-109154643 GCGGGGCCTGGGTGGGGCCTAGG + Intronic
1104376336 12:128267582-128267604 CGGGGGCCTCGGCGGGGGCTCGG + Intronic
1104975968 12:132552117-132552139 ATGGGGCCACAGTGGGGCCTGGG + Intronic
1105021859 12:132822036-132822058 CGGGGGCTTCAGTGGGGCCTCGG + Exonic
1113444213 13:110353004-110353026 AGGGGGCGTCAGTGAGAGCTGGG + Intronic
1113470429 13:110541009-110541031 AGGAGGCCTGGCTGGGTCCTGGG + Intronic
1118390589 14:65292039-65292061 AGGGGGCTTTGGTGGTACCCTGG + Intergenic
1118817978 14:69326042-69326064 ATGGGCCCTTGGTGGGACCCAGG - Intronic
1119646577 14:76352889-76352911 AGGGGCGCGCGGTGGGAACTAGG - Intronic
1120167856 14:81220254-81220276 CGGGGGCGCCGGTGGGGCCTGGG - Intronic
1122800489 14:104226990-104227012 AGGTGGCCCCTGTGGGGCCTGGG + Intergenic
1123008857 14:105337696-105337718 AGGGGGCTCAGGTGGGCCCTGGG - Intronic
1123068688 14:105630578-105630600 ATGGGGCCTCCCTGGGGCCTGGG + Intergenic
1123072683 14:105649380-105649402 ATGGGGCCTCCCTGGGGCCTGGG + Intergenic
1123098275 14:105776606-105776628 ATGGGGCCTCCCTGGGGCCTGGG + Intergenic
1123933360 15:25182504-25182526 AGGGGCCCTCCTGGGGACCTCGG - Intergenic
1130550732 15:84888680-84888702 CGGGGGCCACGGTGAGACCCTGG - Intronic
1131515467 15:93073585-93073607 AGGGGGCGTCGGTGGAAGCTTGG - Intronic
1131905193 15:97134962-97134984 AGGGGGCCCTGGTGGGTCTTGGG - Intergenic
1132215837 15:100061041-100061063 AGTGGGCCTCCGTGGGAGGTTGG - Intronic
1132649411 16:1013814-1013836 AGGGGGCCTGGGCGGGGCCTGGG + Intergenic
1132854072 16:2037045-2037067 AGGGGGCCTCTGTCGGGCCTGGG - Intronic
1134512413 16:14859132-14859154 AGGTGGCCCAGGGGGGACCTAGG + Intronic
1134971775 16:18537027-18537049 AGGTGGCCCAGGGGGGACCTAGG - Intronic
1136016009 16:27401768-27401790 AAGGGGCTTCCGTGGGACCTTGG + Intergenic
1136483062 16:30554992-30555014 AGGGGGCCTTGGAGAGCCCTGGG + Exonic
1138556202 16:57772557-57772579 AGGGGGCATCGGGGTGGCCTTGG - Intronic
1140759724 16:78099889-78099911 AGGGGGCCGCAGTGGGGCCGCGG + Intronic
1141355669 16:83344344-83344366 AGGGGGCCTGAATGAGACCTCGG - Intronic
1141423492 16:83931566-83931588 AGGTGGCCTGGGTGGGAACCTGG + Intronic
1141634053 16:85304346-85304368 AGAGGCCCTCGGTGGGGCCGGGG + Intergenic
1141915507 16:87093937-87093959 CCGGGGTCTGGGTGGGACCTGGG - Intronic
1142033803 16:87851689-87851711 AGGGGCCGCCGGTGGGGCCTGGG + Intronic
1142250439 16:88989497-88989519 ATGCGGCCTCCGTGGGAGCTGGG + Intergenic
1142466621 17:140747-140769 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466636 17:140785-140807 AGGGGACATAGGGGGGACCTTGG + Intergenic
1142466708 17:140964-140986 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466724 17:141002-141024 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466740 17:141040-141062 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466756 17:141078-141100 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466818 17:141233-141255 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466844 17:141295-141317 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466860 17:141333-141355 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466876 17:141371-141393 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142466926 17:141503-141525 AGGGGACATGGGGGGGACCTTGG + Intergenic
1142875462 17:2849596-2849618 AGGGGGCCTGGGTGGGAATCAGG - Intronic
1143634562 17:8156906-8156928 AGGGAGCCTCGGTGGGACCCAGG - Intronic
1144482556 17:15639790-15639812 GGGGGGCCTGGGTGGGGCCCAGG - Intronic
1144916127 17:18725241-18725263 GGGGGGCCTGGGTGGGGCCCAGG + Intronic
1147036622 17:37686370-37686392 AGGGGTTCTCGGTGGAACCATGG + Intergenic
1147156886 17:38548511-38548533 AGGGGGCCTGGCTGAGACCTTGG + Intronic
1147654327 17:42080244-42080266 AGGGGTCCTCACGGGGACCTTGG + Intergenic
1148782710 17:50130482-50130504 AGGCGGCCGCGGCGGGAGCTGGG + Intergenic
1150249232 17:63697093-63697115 AGGGCGCCCCGGTGGGACACAGG - Exonic
1150461956 17:65360927-65360949 AGGGGGGCTTGGTGGCAGCTGGG + Intergenic
1151130462 17:71891652-71891674 TAGGGGGCTCGGTGGGACTTGGG - Intergenic
1151720791 17:75854983-75855005 TGGGGCCCCCGGTGGGGCCTAGG - Intronic
1151942152 17:77299688-77299710 AGGGAGGCTCTGTGGGTCCTTGG + Intronic
1152111560 17:78359979-78360001 AAGGGGCCGCGGCGGGAGCTGGG + Exonic
1152151190 17:78602423-78602445 AGGGGTCCTGGGAGGGGCCTGGG - Intergenic
1152422560 17:80202002-80202024 TGGGGGCCTCCTGGGGACCTGGG - Intronic
1152631873 17:81414144-81414166 AGGGGGCCACGGCTGGTCCTGGG - Intronic
1152748683 17:82052587-82052609 AGGGAGCCCCGGTGGGCCCGGGG + Intronic
1154204713 18:12326903-12326925 AGGGGTGCTGGGTGGGAGCTGGG + Intronic
1154352397 18:13595586-13595608 AGGGGGCCAAGGTGGGAGGTTGG - Intronic
1161396003 19:4045288-4045310 AGGGGGCCTCTCTGGGAGCTGGG + Exonic
1161702721 19:5804231-5804253 AGGGGGCGCCGGCGGGAGCTAGG + Intergenic
1161957711 19:7505873-7505895 AGGTGGGCTCTGTGTGACCTTGG - Intronic
1161968645 19:7563024-7563046 AGGGGGCGTCAGTAGCACCTCGG - Intergenic
1162015618 19:7845084-7845106 AGAGGGCCTCGCTGGGTCCTTGG - Intronic
1162042478 19:7979123-7979145 AGGGAGCCTCGGGGAGACCTGGG + Intronic
1162072005 19:8158574-8158596 AGGGAGCCACGGTGGGTTCTAGG + Intronic
1162376054 19:10305867-10305889 AGTGGGCCTCGGTGCCTCCTGGG + Exonic
1162401372 19:10448796-10448818 GAGGGGACTCTGTGGGACCTAGG - Intronic
1162419509 19:10558084-10558106 GTGGGGCCAGGGTGGGACCTTGG + Intronic
1163251442 19:16128473-16128495 AGGGAGCCCTGATGGGACCTGGG + Intronic
1164860542 19:31558963-31558985 TGGCGGCCTCGCTGGGACATTGG + Intergenic
1165126373 19:33600827-33600849 TGGGTTCCTTGGTGGGACCTGGG - Intergenic
1165342608 19:35223675-35223697 TGGGGGGCTCCCTGGGACCTGGG + Intergenic
1165346197 19:35249981-35250003 AAGGGGCCTCTGTGTGGCCTGGG - Intronic
1165394245 19:35555605-35555627 GGAGGACCTCGCTGGGACCTCGG + Intronic
1166679261 19:44757295-44757317 AGGAGGGCTCGGTGAAACCTAGG - Intronic
1166981661 19:46635128-46635150 AGGGGGCCTCATTAGGGCCTTGG + Intergenic
1166983982 19:46649046-46649068 AGGGGGCCCCGAAGGGACCGCGG + Exonic
1167244571 19:48365465-48365487 AGGGGGCTTCTGTGGGCCCCAGG - Intronic
1167473354 19:49687247-49687269 AGGGGGCTTCCGGGGGAGCTGGG + Intronic
925169878 2:1744079-1744101 AGGGGGACGTGGGGGGACCTGGG - Intronic
925177497 2:1795608-1795630 TGGGGGCCTGGCTGGGAGCTGGG + Intronic
926488399 2:13492032-13492054 AGGGGGCCTCGGGGTCTCCTTGG + Intergenic
927173710 2:20391000-20391022 AGGAGGCCTGTTTGGGACCTTGG + Intergenic
927936719 2:27080291-27080313 ACGGGCCCTTGGTGGGAACTGGG + Intronic
929573619 2:43038967-43038989 TGGTGGCCTCTGCGGGACCTCGG + Intergenic
930034312 2:47075984-47076006 AGGAGGCATGGGAGGGACCTGGG + Exonic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932090263 2:68799948-68799970 AGGATGCCGCGGTGGGAACTGGG + Intronic
933886169 2:86720591-86720613 ACGCGGCCTCGGTGGGGCCCGGG + Exonic
936267067 2:111018711-111018733 AGGGGGTGTTGGTGGGACTTGGG + Intronic
937264567 2:120607790-120607812 AGGGGCCCTGGGTGGGACCTCGG - Intergenic
938073533 2:128320287-128320309 TGGGGTCCTCAGTGGGACCTAGG + Intergenic
940792037 2:158039168-158039190 AGGGGGCCTGGGTGTACCCTAGG + Intronic
942163418 2:173216430-173216452 AGTAGGCCTGGGTGGGACCCTGG - Intronic
946332624 2:219019017-219019039 AGGGGGCCACTGGGGGGCCTGGG - Intronic
946401150 2:219469044-219469066 TTGGGGCCCCGGTGGTACCTGGG - Exonic
947624341 2:231610477-231610499 AGTAGGCCTGGGTGGGGCCTAGG - Intergenic
947742823 2:232492641-232492663 AGCGGGTGTGGGTGGGACCTGGG - Intergenic
948223521 2:236291434-236291456 AGGGGGCAGGGGTGGGACCAGGG + Intergenic
948496180 2:238351293-238351315 AGGAGGACTGGGTGGGACCATGG + Intronic
1169867533 20:10217788-10217810 AGGCTGCCTCGGGGGGCCCTCGG - Intergenic
1172083278 20:32358849-32358871 AGGGGGGCTCCGTGGGGCCCGGG + Intronic
1172625138 20:36342470-36342492 ATGGGGCCTTGGTGGGAGCTGGG - Intronic
1172886005 20:38231255-38231277 AGGGGGCCTGGGAGGCACCATGG - Exonic
1173656656 20:44704377-44704399 GGGGCTCCTCGGTGGGGCCTTGG + Intergenic
1173840155 20:46151885-46151907 GTGGGGCCTCGGCGGGACCTTGG + Intergenic
1173840159 20:46151896-46151918 GCGGGACCTTGGTGGGACCTTGG + Intergenic
1174574983 20:51530851-51530873 TGTGGGACTCTGTGGGACCTGGG - Intronic
1175483432 20:59327523-59327545 CTGGGGCCTCCGTGGCACCTGGG - Intergenic
1178561522 21:33642955-33642977 CGGGGGCCGCGGTGGGCCGTGGG + Intronic
1178708227 21:34890904-34890926 AGGAGCCCTGGGTGGGATCTCGG - Intronic
1179457222 21:41507996-41508018 AGGGGGCATCGGCGGGTCCCAGG + Exonic
1179894745 21:44355185-44355207 AAGGGGGCTCTGTGGGGCCTGGG - Intronic
1179920036 21:44503012-44503034 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920118 21:44503271-44503293 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920148 21:44503363-44503385 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920176 21:44503455-44503477 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920253 21:44503697-44503719 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920281 21:44503789-44503811 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920321 21:44503910-44503932 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920358 21:44504049-44504071 AGTTGGCCTCGGTGAGCCCTTGG + Intronic
1179920403 21:44504218-44504240 AGCCGGCCTCGGTGAGCCCTCGG + Intronic
1179920442 21:44504338-44504360 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179920453 21:44504383-44504405 AGCTGGCCTCGGTGAGCCCTCGG + Intronic
1179954249 21:44729406-44729428 AGGGGGCCTGTGGGGCACCTGGG + Intergenic
1179957480 21:44749611-44749633 TGGAGGCCTCGGTGGGCCCAAGG - Intergenic
1180099579 21:45578276-45578298 AGGGAGCCTGGGAGGGGCCTGGG + Intergenic
1180133382 21:45843114-45843136 AGGGGGACTGGCTGGGCCCTTGG - Intronic
1180833866 22:18920081-18920103 GTGGGGCCTCTGTGGGAACTGGG - Intronic
1180835163 22:18926109-18926131 AGGGGGCCTCGCTGGGGATTTGG - Intronic
1181115575 22:20631062-20631084 AGTGGGCGTTGTTGGGACCTAGG - Intergenic
1181168127 22:20994124-20994146 CGGGGGCCTCCCTGGGAACTGGG - Exonic
1181313982 22:21960278-21960300 AGGGAGCCTCGGTGGGCCCTGGG + Intronic
1182021487 22:27085450-27085472 AGGGGGCCTCAGTAGCAACTTGG - Intergenic
1182351487 22:29702480-29702502 AGGGGCCCTCCTTGGGCCCTGGG + Intergenic
1182520896 22:30884031-30884053 AGTGGGCCTGGGTGAGTCCTGGG - Intronic
1183212690 22:36460703-36460725 AGGAGGCTTTGGTGGGGCCTTGG - Intergenic
1183469182 22:37996645-37996667 AAGAGCCCTGGGTGGGACCTGGG + Intronic
1185065956 22:48631823-48631845 AGGGGGCCTAGGGGGCAGCTGGG + Intronic
1203283952 22_KI270734v1_random:145379-145401 GTGGGGCCTCTGTGGGAACTGGG - Intergenic
1203285251 22_KI270734v1_random:151408-151430 AGGGGGCCTCGCTGGGGATTTGG - Intergenic
951350852 3:21605173-21605195 AGGGGGGCTGTGTGGGACTTGGG + Intronic
953449457 3:42994271-42994293 AGGGGCCCTGGGAGGGAACTAGG + Intronic
954132700 3:48568467-48568489 AGGGGGCCCCTGTGGGAGCAGGG + Intronic
954692242 3:52401803-52401825 TGGGGGCCTGGGTGGGCCCTGGG - Exonic
955991760 3:64635174-64635196 GGAGGGCCTTTGTGGGACCTGGG - Intronic
961662814 3:128479284-128479306 ATGGGGCCTCTGTTGGGCCTGGG - Intergenic
962971169 3:140403428-140403450 AGGAGGTCTGGGTGGGGCCTGGG + Intronic
963661955 3:148137799-148137821 AGGGAGCCTTGGTGGGAGATTGG + Intergenic
967808095 3:193732626-193732648 AGCAGGCCTCTGTTGGACCTTGG + Intergenic
967844693 3:194034392-194034414 AGTGGGTCTGCGTGGGACCTGGG + Intergenic
967972758 3:195011506-195011528 AAGGGGCCTCAGTGAGAACTGGG + Intergenic
968650564 4:1758744-1758766 AGGGAGACTCAGTGTGACCTCGG + Intergenic
968903987 4:3443410-3443432 AGGGGGCCCAGGTGGGTGCTGGG + Exonic
969373452 4:6748320-6748342 AGGGGCCCTCAGCTGGACCTTGG - Intergenic
970148590 4:13065699-13065721 ATGGGGCCTATCTGGGACCTAGG + Intergenic
974011142 4:56608543-56608565 ACAGGGCATCTGTGGGACCTTGG + Intergenic
981964981 4:150589621-150589643 AGGGGTCTTCTGTAGGACCTAGG - Intronic
985553290 5:543886-543908 ACGGAGCCTCGGCGTGACCTCGG - Intergenic
986713369 5:10503665-10503687 AGGGGGTCTCGGTGGCGCCCAGG - Intergenic
989757631 5:44975014-44975036 AGGAGGCGTGGGTGGGAGCTGGG + Intergenic
990448850 5:55917366-55917388 AGGAGGCCTCGGTGAGAGCTTGG - Intronic
999267629 5:150277235-150277257 AGGAGGTGTGGGTGGGACCTTGG - Intronic
999717853 5:154376376-154376398 TGGGGGCCTCAGTGGCAACTGGG + Exonic
1001084272 5:168689143-168689165 AGGGAGTCTGGGTGGGGCCTGGG + Intronic
1001645511 5:173278813-173278835 AGGGGGCCTGGGTGGACGCTGGG + Intergenic
1002296027 5:178231999-178232021 GGGGGCCCTCGGTGGGACGGTGG - Intronic
1002450347 5:179315054-179315076 AGGAGGCCGGGGTGGGGCCTTGG - Intronic
1004016384 6:11735820-11735842 AGGGAGCCACGGTAGGTCCTTGG - Intronic
1006452760 6:34114630-34114652 GGTGGGCACCGGTGGGACCTTGG - Intronic
1007323272 6:41042114-41042136 GTGGGGCCTTGGTGGGGCCTTGG + Intronic
1007654982 6:43446442-43446464 AGGGGTCCTGGGTGGCACCTGGG - Exonic
1013167328 6:107605830-107605852 AGGAGGTCTGGGTGGGACCTGGG - Intronic
1016822219 6:148357507-148357529 AGGGAGCCTGGGTGGAAACTGGG - Intronic
1017628300 6:156370484-156370506 AGGGGGACTGGATGGGAGCTAGG - Intergenic
1019143113 6:169960730-169960752 AGGGCGACTGGGTGGGGCCTTGG + Intergenic
1019410263 7:903751-903773 AGGGGACCTCGGGGGGAACTGGG - Intronic
1019692575 7:2424796-2424818 AGGGGAGCTCTGTGGGAGCTGGG - Intronic
1019701172 7:2475642-2475664 CAGGGGCCTGGGTGGGGCCTGGG - Intronic
1019705926 7:2497421-2497443 GGGGTACCTGGGTGGGACCTGGG - Intergenic
1019995537 7:4722103-4722125 AGGGGACTTTGGTGGGGCCTTGG + Intronic
1022603099 7:31780141-31780163 AGTTGGTCTGGGTGGGACCTGGG + Intronic
1023836674 7:44072740-44072762 AGAGGGCCTGGGTAGGAGCTGGG - Exonic
1023863524 7:44228479-44228501 GGGGGGCCTCGGAGGGGCCAGGG + Intronic
1024001271 7:45190790-45190812 AGGGGGCCTCAGTGCATCCTGGG + Intergenic
1025728172 7:64087208-64087230 ATGGGGCCTCAGAGGGCCCTGGG + Intronic
1027212809 7:76164529-76164551 AGGGGGCCGCGGGGGGACGGGGG + Intergenic
1029616953 7:101665106-101665128 AGGGGGCCTCTGCGGGACTCTGG - Intergenic
1029686646 7:102153211-102153233 ATGGGGCCTGGGTGGGGCTTGGG - Intronic
1032544281 7:132728696-132728718 AGGGGGTCAGGTTGGGACCTTGG + Exonic
1034044391 7:147912652-147912674 AGGAGGCTTCGCTGGGAGCTTGG - Intronic
1034480533 7:151317043-151317065 AGGGAGCTTTGGTGGGAGCTGGG - Intergenic
1034963202 7:155374872-155374894 AGGGGGCTTCCGTGGGTCCGCGG - Intergenic
1035542723 8:454466-454488 ATGGGGCCTCCGAGGGACCCAGG + Intronic
1035637112 8:1155662-1155684 TGGGGGCCTCGGAGGGGCCTGGG - Intergenic
1036456702 8:8915669-8915691 AGGGGGGGGCGGTGGGAGCTGGG + Intergenic
1036482613 8:9151594-9151616 AGGGGGCCTGGGATGGACCCCGG - Intergenic
1037805984 8:22058082-22058104 AGGGGGCCTCGATGGGAGAGTGG + Intronic
1045459139 8:102411966-102411988 AGGGGGCCGCGGGGGGAGCGCGG - Intronic
1049192089 8:141294186-141294208 AGGGTCCCTCGGTTGGCCCTGGG - Intronic
1049379658 8:142305620-142305642 AGGAGGCCGCGGAGGGACCCGGG - Intronic
1049387921 8:142353657-142353679 AGGGGCCCTCGCTGGCTCCTTGG - Intronic
1049414557 8:142489249-142489271 AGGGGCCCTCGGGGGCACCTGGG + Intronic
1049575710 8:143388776-143388798 AGGGGGACTCAGGGGGACCTGGG + Intergenic
1049716632 8:144095986-144096008 AGGAGGCCACGGTGAGACCACGG - Exonic
1049855362 8:144858358-144858380 AGTGGACCTCGGTGGGTCCCTGG - Intergenic
1057306725 9:93916665-93916687 CGGGGGTCATGGTGGGACCTTGG - Intergenic
1058216541 9:102240878-102240900 AGGTGGCCATGGTGGGACCTGGG + Intergenic
1060087147 9:120713773-120713795 AGGGGGCCTCGGTGGCAGGTGGG + Exonic
1060643479 9:125258637-125258659 TGGGGGCCTTTGAGGGACCTGGG + Intergenic
1061015230 9:127977509-127977531 AGGGGGCCTGTGTGTGAGCTGGG - Intronic
1061543238 9:131289580-131289602 AAGGGGCAGAGGTGGGACCTGGG - Intergenic
1061720026 9:132545852-132545874 AGGGGTCCTCGGGAGGCCCTGGG - Intronic
1062080228 9:134619881-134619903 AGGGGGCAGCGGTGGGGCTTAGG - Intergenic
1062116570 9:134812600-134812622 AGGGGGACCCGGGGGGCCCTAGG - Exonic
1062331815 9:136048207-136048229 AGGGGCCCTGGGTGGGCCTTGGG + Intronic
1062345931 9:136115311-136115333 AGGGGTCCTGGGTGAGACCTCGG + Exonic
1062644167 9:137538287-137538309 TGGAGGCGTGGGTGGGACCTCGG - Intronic
1062690444 9:137838766-137838788 GGGGGGCCTCAGTGAGAGCTGGG - Intronic
1186874546 X:13804132-13804154 AGTGGGGCTGGGTGGGACCTGGG + Intronic
1187027336 X:15449157-15449179 AGGGGACCTGGGTTGGACCTTGG + Intronic
1189534576 X:41923407-41923429 AGGGGGCCGCGGCAGGACCATGG + Intronic
1194412861 X:93578098-93578120 AGGGGCCCAGGGTGGGAACTGGG + Intergenic