ID: 1075952813

View in Genome Browser
Species Human (GRCh38)
Location 10:126496747-126496769
Sequence GAAACACATCAAGCACTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075952801_1075952813 29 Left 1075952801 10:126496695-126496717 CCTTGCCAGAGAGGTTTTGAATA 0: 1
1: 0
2: 0
3: 17
4: 188
Right 1075952813 10:126496747-126496769 GAAACACATCAAGCACTTAAGGG No data
1075952804_1075952813 24 Left 1075952804 10:126496700-126496722 CCAGAGAGGTTTTGAATATGGGG 0: 1
1: 0
2: 0
3: 10
4: 128
Right 1075952813 10:126496747-126496769 GAAACACATCAAGCACTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075952813 Original CRISPR GAAACACATCAAGCACTTAA GGG Intronic
No off target data available for this crispr