ID: 1075953321

View in Genome Browser
Species Human (GRCh38)
Location 10:126500903-126500925
Sequence CTCTGTTTGTAGAATTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075953319_1075953321 6 Left 1075953319 10:126500874-126500896 CCTAATGACTAGAACTAAAATTG 0: 1
1: 0
2: 0
3: 13
4: 214
Right 1075953321 10:126500903-126500925 CTCTGTTTGTAGAATTGCCCAGG No data
1075953318_1075953321 13 Left 1075953318 10:126500867-126500889 CCAACGACCTAATGACTAGAACT 0: 1
1: 0
2: 0
3: 2
4: 54
Right 1075953321 10:126500903-126500925 CTCTGTTTGTAGAATTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075953321 Original CRISPR CTCTGTTTGTAGAATTGCCC AGG Intronic
No off target data available for this crispr