ID: 1075953753

View in Genome Browser
Species Human (GRCh38)
Location 10:126504793-126504815
Sequence CCTCTGCGGGGGCCCCCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075953742_1075953753 13 Left 1075953742 10:126504757-126504779 CCCACGCGTCTGGCCGTGATGGT 0: 1
1: 0
2: 0
3: 4
4: 91
Right 1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 170
1075953745_1075953753 0 Left 1075953745 10:126504770-126504792 CCGTGATGGTGATGGATGCAAAC 0: 1
1: 0
2: 5
3: 35
4: 644
Right 1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 170
1075953743_1075953753 12 Left 1075953743 10:126504758-126504780 CCACGCGTCTGGCCGTGATGGTG 0: 1
1: 0
2: 0
3: 5
4: 41
Right 1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075953753 Original CRISPR CCTCTGCGGGGGCCCCCACA GGG Exonic
900149556 1:1172118-1172140 CCTCTCCTGGAGCCCCCAGAGGG - Intergenic
900266419 1:1759533-1759555 CCTCACCAGGCGCCCCCACAGGG + Intronic
900504004 1:3020116-3020138 CCTCTGGGGGGGTCCCCTCTAGG + Intergenic
900547539 1:3237016-3237038 CCACTGCGGGGCCCCACACTTGG + Intronic
900957030 1:5892470-5892492 CCTGTGCAGGGCCTCCCACATGG + Intronic
901851631 1:12019668-12019690 CCTCTGCGGGGGTCCCGCCTCGG + Intronic
902214398 1:14924945-14924967 ACTCCGCGGGGGCCGCCACATGG - Intronic
903307487 1:22423461-22423483 CCTCTGCTGGGCCCACCACAAGG + Intergenic
903875719 1:26472088-26472110 CCTCTTCTGGGGCCCCCAGCGGG + Intergenic
905247456 1:36625082-36625104 CATCTCCAGGGGTCCCCACAAGG + Intergenic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908218606 1:61980737-61980759 CCACTGCGGGGAACCCCGCATGG - Intronic
908395125 1:63718364-63718386 TCTCTGCGGGGGCTGTCACAAGG + Intergenic
912501648 1:110126626-110126648 CCACTGCAGGGGCTTCCACAGGG - Intergenic
915118732 1:153615671-153615693 CCTCTTCTGAGGCCCACACAGGG - Intronic
918711327 1:187734632-187734654 CCTCTGCGTGGCCCTCCCCAAGG + Intergenic
921104141 1:211959335-211959357 CCTCTCCTGGGGCCCCAACCTGG + Intronic
924286573 1:242493712-242493734 CCTCTGCTGGAGGCCCCAGAGGG - Intronic
924567088 1:245207969-245207991 CCTCCGCGGGGGCTTCCAGATGG - Intronic
1063367909 10:5502463-5502485 CCTCTTCGGGAGCCCCCATTTGG - Intergenic
1063379419 10:5575057-5575079 CTCCTGCTTGGGCCCCCACATGG + Intergenic
1063384780 10:5609353-5609375 GCTCTCCTGGGTCCCCCACAAGG + Intergenic
1064354288 10:14603995-14604017 CCTCCGCGGCGCCCCCCGCACGG + Intronic
1067077826 10:43198130-43198152 CCTCTGCGTGGCCCCCTGCAGGG + Exonic
1067091456 10:43267614-43267636 GCTCTGCGGGAGTCCCCAGAGGG - Intergenic
1067764889 10:49077357-49077379 CTTCTGCTGCGGCCCCCAGAAGG - Intronic
1068053687 10:51983478-51983500 CCTCTCCTGGGGCCCCAGCATGG - Intronic
1069595209 10:69665767-69665789 CCTCTGGGGAGGTCCCCAGAGGG - Intergenic
1072691880 10:97577627-97577649 CCCCTGGAGGGGCCCCCAAAAGG - Intronic
1074466993 10:113692213-113692235 CCTCTGCTTGAGCCCACACATGG - Intronic
1075090964 10:119444030-119444052 CCTGTGGGGGGGTCCACACAGGG + Intronic
1075307563 10:121382042-121382064 CCTCTGCCTGGGCTCCCACTTGG + Intergenic
1075953753 10:126504793-126504815 CCTCTGCGGGGGCCCCCACAGGG + Exonic
1076522070 10:131087688-131087710 TCTGTGGGGAGGCCCCCACAGGG - Intergenic
1076562444 10:131375997-131376019 ACTCAGCGTGGGCCCCCCCAGGG - Intergenic
1076642902 10:131931004-131931026 CCTCTCCTGGGGGCCCCACTGGG + Intronic
1077502893 11:2917211-2917233 CCTCAGAGGGGGTCCCCTCAAGG + Intronic
1081746098 11:45473493-45473515 CCTCTGCAGGGCCCTCCCCATGG - Intergenic
1081964626 11:47161960-47161982 CCTCTGCGGGTCCCCCAATAAGG + Exonic
1083025897 11:59550461-59550483 CCTCCGCGGCGGCCCCCGTATGG - Intergenic
1083173736 11:60937014-60937036 CCCCTGCCTGGTCCCCCACAAGG + Exonic
1083332509 11:61905485-61905507 CCTCTGCGTGGTCCCCAGCAAGG - Intronic
1092166852 12:6347868-6347890 CCTCTGGGGGGGCCCTGAGAGGG - Exonic
1092917881 12:13204408-13204430 CCTCTCCGGCTGCCCCCAGAAGG + Intronic
1093490656 12:19700781-19700803 CCTCTCCTGGGGCCCCAACCTGG + Intronic
1095978400 12:47955514-47955536 CCTCTGAAGGGGCTCCCACTTGG + Intergenic
1096559169 12:52423722-52423744 CCTCTGCTGGGCCGCCCACCCGG + Intergenic
1096578464 12:52569475-52569497 CCTCAGAGGGGGCACCCAAAGGG + Intronic
1098264618 12:68705995-68706017 CCGCTGCAGGGGCCTCCACTTGG - Intronic
1102473707 12:113175087-113175109 CCTCCCCGGGGGCCACCAGACGG - Exonic
1104901933 12:132194157-132194179 CCTCAGAGGGGTGCCCCACATGG - Intergenic
1107699965 13:43037132-43037154 CGTCTGGAGCGGCCCCCACAAGG - Intronic
1107877489 13:44803638-44803660 CCTGTGTGGGGGCCCTCCCAGGG - Intergenic
1122978606 14:105181239-105181261 GCTCTGCGGGGGCCGACACGGGG + Exonic
1124640646 15:31393958-31393980 CATCTCAGGGGGCTCCCACAGGG + Intronic
1128758147 15:70196997-70197019 CCTCTGCTGGGGCCTACAGACGG - Intergenic
1131060615 15:89401817-89401839 CATCTGACGGGGCCCCCAGAGGG + Intergenic
1132577262 16:669850-669872 CCTCTGCGGGTCCCCCCCCGGGG - Intronic
1132834641 16:1946696-1946718 CATCGGCAGGGGCCCGCACATGG - Exonic
1136024444 16:27460906-27460928 CCGCTGCGAGGGGCCCCCCATGG - Exonic
1139514691 16:67446200-67446222 CCACTGGGGGAGCTCCCACAGGG + Intronic
1139954928 16:70688544-70688566 CCTCTGCCGGGCCCTCCACTTGG + Intronic
1139962058 16:70723838-70723860 CCTCCTCGGTGGCCACCACATGG - Intronic
1141663653 16:85454644-85454666 CCTCCGCCAGGGCCTCCACAAGG - Intergenic
1141709278 16:85688685-85688707 CATCTGCGGAGGCCACCACTCGG - Intronic
1142086508 16:88186148-88186170 CGACTGCGGGGGCGTCCACAAGG + Intergenic
1142134043 16:88443608-88443630 CCTCTGCAGGGGTCCCCACAGGG - Intergenic
1143031603 17:3971116-3971138 CATCTCTGGGGGCCTCCACAGGG - Intergenic
1145827653 17:27889233-27889255 TCTCTGCTGGGGCCCTCACGTGG + Intronic
1145868688 17:28256608-28256630 GCGCTGCGGTGGCCCCAACACGG - Intergenic
1147196466 17:38770035-38770057 TCTCTGTGGGGGCCACTACATGG + Intronic
1151935431 17:77258078-77258100 CCTCTGCAGGTGCCCGCACAGGG + Intergenic
1152366177 17:79857839-79857861 CCTCTGCTGGGGCTCGCCCAGGG + Intergenic
1156293682 18:35771736-35771758 CCTCTGGGGGTGCCCTCACCAGG + Intergenic
1157862330 18:51152385-51152407 TGTCTGCGGGGGCCACCAGAGGG - Intergenic
1158009834 18:52716123-52716145 CCTCTGCAGGGGCCCTTGCAAGG + Intronic
1161092846 19:2371300-2371322 CCTCCTTGGGGGCCCCCACACGG + Intergenic
1161723385 19:5915593-5915615 CCTCGGCGGGGGCATCCACAGGG - Exonic
1162013320 19:7830686-7830708 CCTCTCCGGGAACCCCCTCAGGG + Intronic
1163518553 19:17779066-17779088 CCTCAGGGAGGGCCCCCACCTGG - Intronic
1163745388 19:19043594-19043616 CCCCTGCTGGCACCCCCACAGGG - Intronic
1165039659 19:33060028-33060050 TCTCTGCTGGGACCGCCACATGG + Intronic
1166038966 19:40191170-40191192 CCTGGGCCGCGGCCCCCACAGGG + Intergenic
1168277058 19:55284305-55284327 CCTCTCCGGGGGTCCCCAGGGGG - Exonic
925158421 2:1664238-1664260 CCTCTGAGGGGCCCCACCCAGGG - Intronic
932590815 2:73065919-73065941 CCTGTCCTGGGGCCCCAACATGG + Intronic
932777481 2:74536786-74536808 CCACTGCAGGGCCCCCCCCAGGG + Exonic
933746615 2:85576442-85576464 CCTCTGCGGTAGCCCCTAAAGGG + Intronic
933898326 2:86831615-86831637 CCTCTGCTGGGACCCACAGATGG + Intronic
934753496 2:96809544-96809566 CCACTGGGGAGGCCCCCGCAGGG - Exonic
936104901 2:109615062-109615084 TCTGTGCGGTAGCCCCCACAAGG - Exonic
943106225 2:183547133-183547155 CCTCTGCCTGGGCTCCCACTTGG - Intergenic
943174823 2:184457294-184457316 TCTCTGAGGGGGCATCCACATGG + Intergenic
947770013 2:232662975-232662997 CCTCTCAGGGGCACCCCACAGGG - Intronic
948797913 2:240414011-240414033 CCTAGGGGGGGGCCACCACAAGG + Intergenic
948840766 2:240647758-240647780 CCTCTGAGGGGGCGGACACAGGG - Intergenic
948982115 2:241499683-241499705 CCTCTGCGGTAGCCCCCAGTGGG - Intronic
1173596817 20:44263936-44263958 GCTCTGAGGGGGACCCCAGAGGG + Intronic
1175922503 20:62456759-62456781 CCTGTGCGGCGGCTCCCACCTGG + Intergenic
1175961986 20:62642070-62642092 CCTCTGCCGCGGGCCCCACGTGG + Exonic
1176256694 20:64156733-64156755 CCTCTGAGGGGGCCAGCCCAAGG - Intronic
1176304971 21:5118542-5118564 CCACTGGGGGAGGCCCCACAGGG + Intronic
1178408770 21:32347181-32347203 CGACTGCGGGGGCCAGCACAGGG + Exonic
1179289148 21:40003634-40003656 CCTCTGCAGGGGGGCTCACAAGG + Intergenic
1179436227 21:41363958-41363980 CCTGGGCTGGGGCCCCCACAAGG + Intronic
1179852084 21:44143488-44143510 CCACTGGGGGAGGCCCCACAGGG - Intronic
1180965310 22:19785028-19785050 CCTCTGCTCAGGGCCCCACAAGG - Exonic
1182089574 22:27584861-27584883 CCTCTAGGATGGCCCCCACACGG - Intergenic
1182575901 22:31272719-31272741 CCTCTGCGGGTGTCCCCTCCAGG - Intronic
1184177273 22:42795437-42795459 CGTCTGCTCCGGCCCCCACAGGG + Intergenic
1184828932 22:46971820-46971842 CCTCTGATGAAGCCCCCACAGGG - Intronic
1185258811 22:49850330-49850352 CCTCTGCAGCAGCCCCCACCTGG + Intergenic
1185351821 22:50343488-50343510 CCTCCGCTCGGGCCTCCACACGG + Exonic
950073163 3:10168656-10168678 CCTCTGCGAGGCTCCCCACTGGG + Intronic
950568506 3:13785984-13786006 CCTTTGGGGGGGCCGCCCCAGGG - Intergenic
953420216 3:42748441-42748463 CCTCTGCTGCTGCCCCAACAGGG + Intronic
953844020 3:46412633-46412655 CTGCTGGGGGTGCCCCCACAGGG + Intronic
953982305 3:47418865-47418887 CCTCAGCGGGGGGCCTCCCAGGG + Intronic
954710336 3:52502265-52502287 CATCTGCGTGGGCCCCCAGGTGG - Intronic
960229461 3:115208308-115208330 CCTCTGCGAAGGGCCTCACAAGG - Intergenic
960901461 3:122558290-122558312 CATGTGCGGGGGTCCCCACAAGG + Intronic
962272028 3:133984372-133984394 CCTCTGCCAGGGCCCCCATGAGG - Intronic
969725684 4:8916765-8916787 CCTCTGCGGGGTGCCCCAAAGGG + Intergenic
970663978 4:18316236-18316258 CCTCTGCTGGGCCCCCCTTATGG - Intergenic
974047445 4:56908895-56908917 CGCCGGAGGGGGCCCCCACACGG - Intronic
974564219 4:63563416-63563438 CCTCTGCCTGGGGCCTCACATGG + Intergenic
983904253 4:173168591-173168613 GCTCTGCGGTGGCCGCCAGAGGG + Intergenic
987160051 5:15132706-15132728 CCTCTGCTGGGGCCCCAGCTTGG - Intergenic
993653006 5:90544489-90544511 CATCTGTGGGGACCCCAACATGG - Intronic
997183419 5:131857516-131857538 CCTCTCCTGGGGCCCCAGCATGG + Intronic
998393339 5:141801985-141802007 CCACTGGGGGGGCCCCCATCTGG + Intergenic
998417042 5:141953611-141953633 CCTCAGCGGGGTCACCCACAGGG + Intronic
1002099777 5:176851657-176851679 CCTCTCCGGGGGCCACCCGAGGG - Intronic
1004224332 6:13772370-13772392 CCTCTGCCTGGGCTCCCACTTGG + Intergenic
1004344072 6:14832082-14832104 CCTCTGCTGGGGCTCCCAGTTGG - Intergenic
1006019742 6:31111097-31111119 CGTCTGCAGGGGCCCCTAGAGGG + Intergenic
1013155575 6:107489507-107489529 ACTCTGCGGTGGCCCCCGGAGGG + Intergenic
1015749750 6:136548865-136548887 CCTCTCCCGGGGCCCTCACTTGG + Intronic
1015851339 6:137575631-137575653 CCTTTAAGGGGGCCCCCAGAAGG - Intergenic
1018729820 6:166640429-166640451 CCTCTCCCGGGGCTGCCACACGG - Intronic
1019527528 7:1487434-1487456 CCTCCGGGGGGGCCCCCTGAGGG + Exonic
1021953182 7:25796189-25796211 CCTCTGCAGGGGAGGCCACAGGG + Intergenic
1021955388 7:25819314-25819336 GATCTGGGAGGGCCCCCACAAGG + Intergenic
1023888126 7:44375171-44375193 CCTCTGAGGGGACCCTCCCAGGG + Intergenic
1027198488 7:76047793-76047815 CCTCTGCCTGGGGCCCCACCTGG + Exonic
1029988768 7:104944313-104944335 CCTTTGAGGGGGTCCCCAGATGG - Intergenic
1030167079 7:106566065-106566087 CCTCTTCTGGAGCCCCCAGAAGG + Intergenic
1031330022 7:120452922-120452944 CCTCTCCTGGGGCCCCAACCTGG + Intronic
1032055007 7:128677183-128677205 CCTCTAGGTGGGCACCCACATGG + Intronic
1032094829 7:128932781-128932803 CCTCTGTGGGGGACCCCTCCAGG - Intergenic
1034825223 7:154256315-154256337 CTTCTGCAGGGGCCCCTGCATGG - Intronic
1035601885 8:902059-902081 CCTCTGCGGTGGACCCACCAGGG - Intergenic
1036664909 8:10731689-10731711 CCTCTGTGGAGCCCCGCACATGG - Intronic
1037946972 8:22995823-22995845 CCTCTGCGGAGCCCACCCCATGG - Intronic
1042819946 8:72919302-72919324 TCTCAGCAGTGGCCCCCACAAGG + Intronic
1043388858 8:79771673-79771695 CCTCTGGGGAGGCCCTCACCTGG - Intergenic
1045689579 8:104746622-104746644 TCTCTGCAAGGGCCCCTACAGGG + Intronic
1048270845 8:133026786-133026808 CCTGTGAGGGGGCACCCACTGGG - Intronic
1049009992 8:139880912-139880934 TCACTGCCGGGGCTCCCACAGGG + Intronic
1049249395 8:141580214-141580236 CCTCCGCGGGAGCCCACAGATGG - Intergenic
1049249888 8:141582666-141582688 CCTCTGCGGGAGCCCACGGATGG - Intergenic
1049287938 8:141786702-141786724 CGTCTGAGGTGGACCCCACAGGG + Intergenic
1056600617 9:88043925-88043947 CCCCTGCTGGGACCCCCAAAGGG + Intergenic
1057200425 9:93136910-93136932 CCTCTGTGGAGGAGCCCACAGGG + Intergenic
1057220854 9:93257058-93257080 GCTGAGCGGGGGCCCCCACCTGG - Exonic
1057546117 9:96021455-96021477 CCTCTGCGGGGTCCGCCCCTCGG + Intergenic
1061095911 9:128456660-128456682 CCTCTCCTCGGGCCTCCACATGG + Intronic
1061283342 9:129609607-129609629 CCTCCCCAGGGGCCCCAACAGGG - Intronic
1061793498 9:133070978-133071000 ACTCTGCAGGGACCCCAACATGG + Exonic
1061796106 9:133086777-133086799 ACTCTGCAGGGACCCCAACATGG + Intronic
1062082745 9:134633033-134633055 CCTGTGCAGGGCCTCCCACAGGG - Intergenic
1062348685 9:136128054-136128076 CATCTGCGCAGGGCCCCACAGGG - Intergenic
1062412461 9:136432001-136432023 CCTCTGCCTGTGCCCACACATGG - Intronic
1062461714 9:136665183-136665205 CCCCTGCGCCGGCCCCCACCTGG - Intronic
1187255311 X:17636588-17636610 CCTCTGCGGAGGCTGACACAGGG + Intronic
1190345343 X:49332068-49332090 CCGCTGCGGGGGCGCTCACCAGG - Intronic
1193580736 X:83259936-83259958 CCTCTCCCAGGGCCCCAACATGG + Intergenic
1194663836 X:96655831-96655853 CCTCTACTGGGGCCCCAACCTGG + Intergenic
1195799369 X:108689600-108689622 GCTCTGCTGGGGCTCACACAAGG + Intronic
1195896440 X:109749806-109749828 CCTCTGCCTGGGCTCCCACTTGG - Intergenic
1198811228 X:140538374-140538396 CCTCTGCGCAGGCCACCTCAAGG + Intergenic