ID: 1075953792

View in Genome Browser
Species Human (GRCh38)
Location 10:126505085-126505107
Sequence CGGGATCTTTTTCTATTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 120}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075953792_1075953795 26 Left 1075953792 10:126505085-126505107 CCTGCAAATAGAAAAAGATCCCG 0: 1
1: 0
2: 1
3: 0
4: 120
Right 1075953795 10:126505134-126505156 AGACAGTAAACTCTCTTTCAAGG 0: 1
1: 0
2: 0
3: 21
4: 214
1075953792_1075953796 27 Left 1075953792 10:126505085-126505107 CCTGCAAATAGAAAAAGATCCCG 0: 1
1: 0
2: 1
3: 0
4: 120
Right 1075953796 10:126505135-126505157 GACAGTAAACTCTCTTTCAAGGG 0: 1
1: 0
2: 0
3: 17
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075953792 Original CRISPR CGGGATCTTTTTCTATTTGC AGG (reversed) Exonic
903336845 1:22630134-22630156 CGGGAGATTTTTTTTTTTGCTGG + Intergenic
904557911 1:31377254-31377276 TGGGAACTTTTCCCATTTGCTGG + Intergenic
904736081 1:32634974-32634996 TGGAATCTTTTTTTTTTTGCGGG + Intronic
906637637 1:47419776-47419798 CCGGATCTTTTGCTACCTGCTGG - Intergenic
909238296 1:73180756-73180778 CGGGATCTTTTGCCCTTTCCAGG - Intergenic
910969376 1:92839863-92839885 CAGGATCTTGTTCTGTTTCCTGG + Intronic
911929874 1:103888599-103888621 TGGGATGTTTTTCCATTTGTCGG - Intergenic
1065661118 10:28005062-28005084 TGGGATCATTCTCTATGTGCAGG - Intergenic
1068808827 10:61232478-61232500 CTGGATCTCTTTTTATTTTCTGG - Intergenic
1071045941 10:81377534-81377556 TGGGATATTTTTCCATTTACTGG + Intergenic
1073118438 10:101106774-101106796 CAGGAACTTTTTCTCTTGGCAGG + Intronic
1073135285 10:101216843-101216865 CGGGATCTTTATTTATACGCTGG + Intergenic
1073247847 10:102104385-102104407 CTGGATCTGTTTATATGTGCAGG - Intergenic
1073247951 10:102105060-102105082 CTGGATCTGTTTATATGTGCAGG - Intergenic
1075953792 10:126505085-126505107 CGGGATCTTTTTCTATTTGCAGG - Exonic
1078884008 11:15481826-15481848 CTGAATCTTTTTCTATCTGATGG - Intergenic
1079335150 11:19564549-19564571 CGTGTTCTTTTTCCATTTGGAGG + Intronic
1080462381 11:32466549-32466571 ATGGATCTTTGTGTATTTGCTGG - Intergenic
1085371026 11:76005616-76005638 TGGGATCTGATACTATTTGCAGG - Intronic
1087846736 11:102982209-102982231 TGGGATCATTTGTTATTTGCTGG - Intergenic
1087909272 11:103734678-103734700 TGGGATGTTTTTGTATTTCCTGG - Intergenic
1088208569 11:107425051-107425073 TGGGCTTTTTTTCTTTTTGCAGG - Intronic
1090178631 11:124673899-124673921 CCGGTTGTTTTTCTAGTTGCTGG - Exonic
1092783875 12:12010676-12010698 CCGGCTCTTTTTCTGATTGCAGG - Intergenic
1093350111 12:18089394-18089416 GAGGTTCTTTTTCTATTTCCTGG - Intronic
1095900195 12:47320082-47320104 CTGGATCTTTCTCCCTTTGCTGG - Intergenic
1096040766 12:48514448-48514470 CGGGATCTTATTCTTTTTTGTGG + Intronic
1097318185 12:58195872-58195894 TGGGATGTTTTTCCATTTGTTGG + Intergenic
1099810167 12:87570242-87570264 CAGGATCTTTTTCAGTTTACAGG - Intergenic
1099826919 12:87787954-87787976 CGGGATTTTTTTCTCTTTTAAGG + Intergenic
1101644656 12:106620088-106620110 CTGGATCTATTTCTATTATCTGG + Intronic
1102616150 12:114156109-114156131 CCTGATCTGTTCCTATTTGCTGG + Intergenic
1105478610 13:20751784-20751806 CGGGATGTCTTTCCATTTGTTGG + Intronic
1109815335 13:67574956-67574978 CTTGCTCCTTTTCTATTTGCTGG + Intergenic
1112075011 13:95903403-95903425 CGGAATCTTTTTGGAGTTGCTGG - Intronic
1116880190 14:50159892-50159914 CGGCATATTTTTCTGTTTGATGG - Exonic
1118313670 14:64710809-64710831 GGGGATCTTTTTTTTTTTGGAGG + Intronic
1120485282 14:85105260-85105282 CATCATCTTTTTATATTTGCTGG - Intergenic
1122386314 14:101350701-101350723 CTGGATTTTTATCTATTTTCTGG - Intergenic
1122964664 14:105116917-105116939 CGGGATCTGATTGTAATTGCAGG + Intergenic
1125813147 15:42559359-42559381 CTGTATCTTTTTCTAGTTTCAGG - Exonic
1126241417 15:46448997-46449019 TGGGATCTTTTTCTGTTGACTGG + Intergenic
1130733628 15:86525253-86525275 TGGGATATTTTTCCATTTGTCGG - Intronic
1140020768 16:71236523-71236545 CAGCAAATTTTTCTATTTGCTGG - Intergenic
1141785132 16:86194592-86194614 AGGGATCTTTTTGTAAGTGCTGG + Intergenic
1141843320 16:86589037-86589059 CAGGATCTATTTCTTTTTTCAGG + Intergenic
1148981446 17:51579163-51579185 TGGAATCTTTTTCCATTTGTTGG - Intergenic
1149292821 17:55233891-55233913 CGGTATCTTTTTCTACCTACTGG + Intergenic
1149943311 17:60894215-60894237 TGGGATGTTTTTCCATTTGTTGG + Intronic
1151169129 17:72231986-72232008 CAGCATCTTGTGCTATTTGCTGG - Intergenic
1154940323 18:21106612-21106634 CGGGAGCTATTTCTCTTTTCCGG - Intronic
1156578769 18:38350897-38350919 CACAATCTTTTTCTCTTTGCTGG - Intergenic
1158230933 18:55254258-55254280 GGGGATTCTTTTCTTTTTGCAGG + Intronic
1158537042 18:58317627-58317649 AGGAACCTTTTTCTATTTTCTGG - Intronic
1159139919 18:64381325-64381347 GGGCATCTTCTGCTATTTGCTGG - Intergenic
1168060291 19:53888197-53888219 CAGGATCCTTTTCAATGTGCTGG - Intronic
929930092 2:46247930-46247952 TGGGATATTTTTCCATTTGTTGG + Intergenic
936869552 2:117118701-117118723 CAGGATCTTATTCTTTTTGATGG + Intergenic
941166477 2:162088494-162088516 TTGGTTCTTTTTCTATTTGAGGG - Intergenic
941356465 2:164499257-164499279 CAGGATCTTGTTTTATTTCCTGG - Intronic
941540325 2:166774094-166774116 TGGGATATTTTTCTATTTATTGG + Intergenic
943067186 2:183100913-183100935 CGGGATCTTATTCTTTTTTATGG + Intergenic
945809598 2:214532711-214532733 TGGCAGCTTTTTCTATTTGATGG + Intronic
947598526 2:231429735-231429757 AGGGATCCTTTTCATTTTGCTGG - Intergenic
1170057997 20:12228385-12228407 CAGGATCTGGTTCTATTTTCTGG + Intergenic
1177079074 21:16616231-16616253 CAGAATCTTTTTTTTTTTGCGGG + Intergenic
1182341860 22:29629079-29629101 TGTGATCTATTTCTATTTGGTGG + Intronic
1183366550 22:37410047-37410069 CGTGATCTTTGTGCATTTGCTGG - Intronic
1184816759 22:46878013-46878035 CGTGATTTTTTTCTACTTGTAGG + Intronic
951019087 3:17762995-17763017 TTGGATCCTTCTCTATTTGCCGG + Intronic
952690472 3:36199261-36199283 CGTGATCTTTTTTTTGTTGCTGG - Intergenic
952886116 3:38011836-38011858 AGGGGTCTTTTTCTATTTGCTGG + Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
956783953 3:72626865-72626887 CTGGCTCTTTTTCCTTTTGCAGG - Intergenic
957531888 3:81451203-81451225 GAGGATCTTTTTCTAGTTGGTGG - Intergenic
962680524 3:137795110-137795132 TGTGACCTTTTTCTATTTGAAGG - Intergenic
965871788 3:173274226-173274248 CGGCCTCTTTTTCAATCTGCAGG - Intergenic
967625442 3:191678409-191678431 GTGGATCTTTGTCTATTTCCTGG + Intergenic
968429611 4:548909-548931 CTAAATCTTTTTCTATTTACAGG + Intergenic
969837673 4:9856781-9856803 CGTGATCTTTTTCTTTTTTATGG - Intronic
971325242 4:25638118-25638140 AGGGATCTTTTTCTCCTTACAGG - Intergenic
972472475 4:39420177-39420199 CAGGATCTTTTAGTATTTGGGGG + Intronic
972843917 4:42964698-42964720 AGGGATCTTTGCCTGTTTGCTGG + Intronic
973026848 4:45283894-45283916 CAGGATCTTGTTCTATGTCCAGG + Intergenic
979220587 4:118219044-118219066 TGGAATGTTTTTCCATTTGCTGG - Intronic
979539674 4:121867063-121867085 TGGGATGTTTTTCCATTTGTTGG + Intronic
979996559 4:127438585-127438607 TGGGATGTTTTTCCATTTGTTGG - Intergenic
981183538 4:141774118-141774140 ATGGATTTTTTTCAATTTGCAGG + Intergenic
982474209 4:155830678-155830700 CATAATCTTTATCTATTTGCAGG + Intronic
983731876 4:171004801-171004823 TAAGATGTTTTTCTATTTGCTGG + Intergenic
987548165 5:19340822-19340844 TGGAATGTTTTTCTATTTGTTGG + Intergenic
993708575 5:91199134-91199156 TGGGATGTTTTTCCATTTGTTGG - Intergenic
994100409 5:95884940-95884962 AGGGATCTTTTTCTAAGTGTAGG - Intergenic
999464922 5:151793800-151793822 CGGGATCTTGTTATATTGCCCGG - Intronic
1000879833 5:166684677-166684699 CTGGATATTTCTCTATTTCCAGG - Intergenic
1003639920 6:7868103-7868125 GGAAATCTTTGTCTATTTGCAGG + Intronic
1004080977 6:12392963-12392985 CAGCATCATTTTCTACTTGCAGG + Intergenic
1005368110 6:25099767-25099789 CAGCATCTTTTTATCTTTGCTGG + Intergenic
1010618831 6:78048056-78048078 TGGGATGTTTTTCCATTTGTTGG + Intergenic
1015542087 6:134325010-134325032 TGGGTTCTTTGTCTCTTTGCTGG - Intergenic
1016695590 6:146991096-146991118 CAGTAGCTTTTTATATTTGCTGG + Intergenic
1030227992 7:107173463-107173485 TGGGATCATTTTCTTTTTGAAGG - Intronic
1030479449 7:110083760-110083782 GGGGGTCTCTTTTTATTTGCGGG + Intergenic
1031406016 7:121388337-121388359 TGGGATACTTTTCTAGTTGCTGG - Intronic
1033532186 7:142275484-142275506 AGGGATCTATGTCTCTTTGCAGG - Intergenic
1033707500 7:143903307-143903329 AGGGATGTGTTTCTCTTTGCAGG + Intergenic
1038072417 8:24031692-24031714 AAGAATCTTTTTCTATTTTCTGG + Intergenic
1038537876 8:28367448-28367470 CAGGATCGTTTATTATTTGCTGG - Intronic
1039396612 8:37231261-37231283 CTGGTTCTTTATCTAGTTGCTGG + Intergenic
1040844927 8:51827571-51827593 CAGGATTTTGTACTATTTGCAGG + Intronic
1042794790 8:72649766-72649788 CATGATCTTTTTCTCTTTGTGGG + Intronic
1048994312 8:139782651-139782673 CTGGCTGATTTTCTATTTGCTGG - Intronic
1050339130 9:4618237-4618259 CCAGATCCTCTTCTATTTGCAGG - Intronic
1054867352 9:70016073-70016095 AAGCATCTTTTTCTAATTGCAGG + Intergenic
1057757927 9:97852450-97852472 CAGGATCTGTCTCTATTTGATGG - Intergenic
1058353396 9:104054230-104054252 CGGTATGTTTTTGTAGTTGCTGG + Intergenic
1059379448 9:113911808-113911830 GGGGATGTTTTGCTATTTACAGG + Intronic
1059902007 9:118938289-118938311 TGGGATGTTTTTCCATTTGTTGG + Intergenic
1185562794 X:1072639-1072661 TTGGATGTTTTTCTGTTTGCAGG + Intergenic
1188929758 X:36093082-36093104 CTGAATCTTTTTCTTTTTGATGG + Intronic
1193748926 X:85319003-85319025 TGGGATGTTTTTCCATTTGTTGG + Intronic
1199636119 X:149812605-149812627 CAGGATCTTCTTCAATTTGATGG + Intergenic