ID: 1075954936

View in Genome Browser
Species Human (GRCh38)
Location 10:126515384-126515406
Sequence AGAAAATGGCCTACCTGTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 2, 2: 2, 3: 55, 4: 314}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075954936 Original CRISPR AGAAAATGGCCTACCTGTAT AGG (reversed) Intronic
903076794 1:20775643-20775665 AAAAAATGGTATACCTGTGTAGG - Intronic
907081824 1:51630523-51630545 AAAAAATGGTACACCTGTATAGG + Intronic
907087592 1:51691052-51691074 AAAAAATGGTATGCCTGTATAGG + Intronic
907577620 1:55541600-55541622 AGAAACTGGCACACCTGTACAGG - Intergenic
908309224 1:62859481-62859503 AAAAAATGGTGTACCTGTGTAGG + Intronic
908500339 1:64737249-64737271 AGAAAATGGCATACCTGTATAGG - Intergenic
908771078 1:67596413-67596435 AAAAAATGGTATACCCGTATAGG + Intergenic
911195568 1:94991527-94991549 AGAAAATGGGACACCTGTATAGG + Intronic
911327542 1:96486468-96486490 AAAAAATGGCATGCTTGTATAGG - Intergenic
911525956 1:98985625-98985647 AAAAAATGGTACACCTGTATAGG - Intronic
912909412 1:113742642-113742664 AAAAAATGGTACACCTGTATAGG + Intronic
914440176 1:147698659-147698681 TGAAAATGGCATACCTGGGTGGG - Intergenic
917402277 1:174663219-174663241 TAAAAATGGCACACCTGTATAGG - Intronic
917449908 1:175139008-175139030 AAAAAATGGCCAATCTGTAAGGG + Intronic
917633315 1:176911170-176911192 AAAAAATGGTCCACCTGTAAAGG + Intronic
918031508 1:180817455-180817477 AAAAAATGGTACACCTGTATAGG - Intronic
919156988 1:193777807-193777829 AAAAAAAGGTCCACCTGTATAGG - Intergenic
919619906 1:199852657-199852679 AGAAAATTTCCTAATTGTATTGG - Intergenic
920324410 1:205151142-205151164 AAAAAATGGTATACCTGTAGAGG + Intronic
920815168 1:209324560-209324582 AGAAAATGGCCTACCTGTGCTGG - Intergenic
922282747 1:224141748-224141770 AAAAAATGGTACACCTGTATAGG + Intronic
923601189 1:235404437-235404459 AGAAAATGGTATGCCTGCATAGG + Intronic
923924943 1:238615509-238615531 ACAAAATGGCCAACATGTGTTGG + Intergenic
924163887 1:241262187-241262209 AGAAGAAGGCCTCTCTGTATGGG + Intronic
924435348 1:244035289-244035311 ATAAAATGGCGCACCAGTATAGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1065350195 10:24788697-24788719 ATAAAATGGTATACCTGTATAGG - Intergenic
1065604428 10:27402675-27402697 GAAAAATGGTCCACCTGTATAGG - Intronic
1067124151 10:43501216-43501238 AAAAAATGGTATACCTGTATAGG + Intergenic
1067124375 10:43503579-43503601 AAAAAATGGCACACCTGTATAGG - Intergenic
1067758470 10:49025286-49025308 AGAAAATAGCCTTCCTGAAGGGG + Intronic
1067826133 10:49574409-49574431 ACAAAATGGCACACCTGGATAGG + Intergenic
1068213246 10:53950442-53950464 AAACAAAGGCCTACCTATATAGG + Intronic
1068288216 10:54966979-54967001 AAAAAATGGTACACCTGTATAGG + Intronic
1068546388 10:58351032-58351054 AAAAAATGGTATGCCTGTATAGG + Intronic
1068638234 10:59371472-59371494 TAAAAATGGCATACCTGTATAGG + Intergenic
1068784494 10:60956269-60956291 AAAAAATGGTATGCCTGTATAGG + Intronic
1068820410 10:61371139-61371161 AAAAAATGGTACACCTGTATAGG + Intergenic
1070600038 10:77859451-77859473 AAAAAATGGTCCACCTGTACAGG - Intronic
1071313245 10:84364086-84364108 AAAAAATGGTATACCAGTATGGG + Intronic
1071780154 10:88835635-88835657 ATAAAATGGTACACCTGTATAGG + Intronic
1071857211 10:89637574-89637596 AAAACGTGGCATACCTGTATAGG + Intronic
1073032904 10:100542146-100542168 AAAAAACGGTATACCTGTATAGG + Intronic
1073851027 10:107618369-107618391 AAAAAATGGTATACCTGTATAGG - Intergenic
1074626208 10:115189905-115189927 AAAAAATGGTATACCTGTATAGG - Intronic
1075770025 10:124926099-124926121 AAAAAATGGTACACCTGTATAGG + Intergenic
1075954936 10:126515384-126515406 AGAAAATGGCCTACCTGTATAGG - Intronic
1077978456 11:7274661-7274683 AGAGAAGGGCCCAGCTGTATAGG - Intronic
1078644553 11:13128311-13128333 GAAAAATGGCACACCTGTATAGG - Intergenic
1079437034 11:20466461-20466483 AGAACATGGCCTACCTGGGTTGG - Intronic
1080617588 11:33958286-33958308 TAAAAATGGTATACCTGTATAGG + Intergenic
1080696364 11:34606224-34606246 GGAGAATGGCCTGCCTGTTTGGG + Intergenic
1084135483 11:67176796-67176818 AAAAAATGGTATACCTGTATAGG + Intronic
1085180396 11:74530653-74530675 TAAAAATGGTATACCTGTATAGG - Intronic
1085854048 11:80155932-80155954 AGAAAGTGGCTGACCTGTGTGGG + Intergenic
1087276286 11:96163580-96163602 AGAAGATGGAGTAGCTGTATAGG - Intronic
1088383847 11:109227321-109227343 AAAAAATGGTATACCTATATAGG + Intergenic
1090093302 11:123718890-123718912 AAAAAATGGTCCACCTGTATAGG + Intergenic
1090147718 11:124343854-124343876 TAAAAATGGTATACCTGTATAGG + Intergenic
1090418806 11:126559206-126559228 ACAAAATGGTCTCCCTGTTTTGG - Intronic
1090652329 11:128818109-128818131 AAAAAATGGTACACCTGTATAGG + Intergenic
1090718059 11:129447651-129447673 AGAAAATGGTCTAATTGTTTTGG + Intronic
1091628883 12:2143431-2143453 AAAAAATGGTGCACCTGTATAGG - Intronic
1091744856 12:2984810-2984832 AACAAATGGCACACCTGTATGGG + Intronic
1092624283 12:10309791-10309813 AGAAATTTGCCTACCAGTGTAGG + Intergenic
1093218198 12:16387514-16387536 AAAAAATGGTATACCTGTATAGG - Intronic
1093904119 12:24669534-24669556 GTAAAATGGCACACCTGTATAGG - Intergenic
1094394535 12:29991796-29991818 AGAAAATGGCCTGTCAGGATGGG + Intergenic
1094470712 12:30798594-30798616 AGAAACTGACCTGCCTGTAAAGG - Intergenic
1094618000 12:32053516-32053538 AAAAAATGGTACACCTGTATAGG - Intergenic
1095149661 12:38777619-38777641 ATAAAATGGTATACCTGTGTAGG - Intronic
1095381733 12:41602851-41602873 AAAAAATAGTATACCTGTATAGG + Intergenic
1096911902 12:54992358-54992380 AAAAAATGGTACACCTGTATAGG + Intergenic
1100314312 12:93430107-93430129 AAAAAATGGTATACCTGTATAGG - Intronic
1100457034 12:94762481-94762503 TAAAAATGGCACACCTGTATAGG - Intergenic
1100692653 12:97055219-97055241 AAAAAATGGTACACCTGTATAGG - Intergenic
1100705123 12:97192550-97192572 AAAAAATGGTATACCTGTACAGG - Intergenic
1100771496 12:97927892-97927914 AAAAAATGGCCAACGTTTATTGG + Intergenic
1101056343 12:100919368-100919390 AAAAAATGGTCTCTCTGTATAGG - Intronic
1101127406 12:101651337-101651359 TAAAAATGGCCTACCTGTTCAGG + Exonic
1101595101 12:106157376-106157398 AGAAAATGGTACCCCTGTATAGG + Intergenic
1101772576 12:107765054-107765076 AAAAAATGGTATGCCTGTATAGG + Intergenic
1102131464 12:110532682-110532704 AAAAAATGGTACACCTGTATAGG - Intergenic
1102200910 12:111057110-111057132 AGAAAATGGCCAAGCTGCAATGG + Intronic
1104575207 12:129960317-129960339 ATAAAATTGCATACATGTATTGG + Intergenic
1105795966 13:23853315-23853337 AAAAAATGGTATACCTGTATAGG - Intronic
1106638232 13:31554172-31554194 AGAGAATGCCTTACCTGTACAGG - Intergenic
1107776480 13:43849042-43849064 AGAAAATGGTCTGACTATATTGG + Intronic
1107895883 13:44962769-44962791 AAAAAATGGTATACCTGAATGGG - Intronic
1108324002 13:49312382-49312404 AAAAAATGGTACACCTGTATAGG - Intronic
1108531071 13:51327921-51327943 TTAAAATGGCGCACCTGTATAGG - Intergenic
1108583440 13:51847028-51847050 AAAAAATGGTGCACCTGTATAGG - Intergenic
1108599270 13:51976818-51976840 AAAAAATGGTGCACCTGTATGGG + Intronic
1109229599 13:59740876-59740898 AGAAAATGGCCTTCATGCTTTGG - Intronic
1109999109 13:70170996-70171018 AAAAAATGGTACACCTGTATAGG + Intergenic
1110769627 13:79325862-79325884 AAAACATGGTATACCTGTATGGG - Intronic
1110786130 13:79528610-79528632 ATAAAGTGGCCGACCTGGATAGG - Intronic
1111316572 13:86569393-86569415 AAAAAATGGTACACCTGTATAGG - Intergenic
1112030512 13:95452306-95452328 AGAAACAGCCCTCCCTGTATTGG + Intronic
1112132244 13:96536899-96536921 CTAAAATGGACCACCTGTATAGG - Intronic
1114922043 14:27343872-27343894 AGAAATTGGCCAACATGTAGGGG - Intergenic
1115830991 14:37340896-37340918 AAAAAATGGTATACCTGTACAGG - Intronic
1116700875 14:48239926-48239948 AAAAAATGGTATACCTGTATAGG + Intergenic
1116753753 14:48919985-48920007 AAAAAATGGTACACCTGTATAGG + Intergenic
1116799215 14:49425728-49425750 ATAAAATGCCCTTCCTTTATGGG - Intergenic
1116885890 14:50220875-50220897 AGCAAATGACCTGCCTTTATGGG - Intronic
1117456285 14:55900070-55900092 AAAAAATGGCACACCTGTAGAGG + Intergenic
1117631722 14:57700311-57700333 AGAAAATGGTACACCTGTATAGG + Intronic
1118791924 14:69101888-69101910 AAAAAATGGTACACCTGTATAGG + Intronic
1120131400 14:80811586-80811608 AGAAAATGGCATATATATATAGG + Intronic
1120587390 14:86329990-86330012 ACAAAATGGTGCACCTGTATAGG + Intergenic
1121434451 14:93909971-93909993 AGACAATGGCCTGCCTGTGTAGG - Intergenic
1123889030 15:24757047-24757069 AAAAAATGGCACACCTGTATAGG + Intergenic
1124796849 15:32789759-32789781 AGAAAATGGTACACCTGTGTAGG - Intronic
1125519918 15:40342665-40342687 TTAAAATGGCACACCTGTATAGG - Intergenic
1125758161 15:42079738-42079760 GGACAATGGCCCACCTGTACGGG - Exonic
1125922844 15:43536121-43536143 AGAAAATGGTTTACCTGGCTGGG + Intronic
1126204757 15:46033216-46033238 AAAAAATGGTACACCTGTATAGG - Intergenic
1126402687 15:48289747-48289769 AAAAAATGGTCCACTTGTATTGG + Intronic
1126548184 15:49895744-49895766 AGAAAATGACCTAAATGTAGAGG + Intronic
1126701983 15:51376365-51376387 TTAAAATGGCTCACCTGTATAGG + Intronic
1127550813 15:60036714-60036736 AAAAAATGGCACACCTGGATAGG - Intronic
1128588169 15:68869796-68869818 AAAAAATGGTACACCTGTATAGG - Intronic
1130156324 15:81353484-81353506 AAAAAATGGTACACCTGTATAGG - Intronic
1131601959 15:93858578-93858600 AAAAAATGGCATACTTGTGTAGG + Intergenic
1132073899 15:98803349-98803371 AAAAAATGGTACACCTGTATAGG + Intronic
1134158147 16:11860920-11860942 TAAAAATGGCACACCTGTATAGG - Intergenic
1138242821 16:55442184-55442206 AGAGAATGGTACACCTGTATAGG - Intronic
1139452266 16:67039326-67039348 AAAAAATGGTATACCTGTATAGG + Intronic
1139761817 16:69190136-69190158 TAAAAGTGGCCTACCTGGATGGG - Intronic
1139819891 16:69713014-69713036 AGAAAATGAGGTACCTGAATTGG + Exonic
1141257911 16:82420380-82420402 TGAAAATGGTACACCTGTATAGG - Intergenic
1143440767 17:6971717-6971739 TCAAAATGGCATACCTGTACAGG + Intronic
1143808410 17:9449804-9449826 AGAAGAGGGTCTACCTGTAAAGG + Intronic
1144370176 17:14582981-14583003 AAAAAATGGTATACTTGTATAGG - Intergenic
1145735412 17:27226861-27226883 AGAAAATGGTACACCTGGATAGG - Intergenic
1146813112 17:35919597-35919619 AAAAAATGGTATAGCTGTATAGG + Intronic
1149602654 17:57903276-57903298 AGAACATGGCCTCCCTGTCCTGG + Intronic
1152474596 17:80509762-80509784 AAAAAATCACCTGCCTGTATTGG - Intergenic
1155439716 18:25849698-25849720 AAAAAATGGCACACCTATATAGG - Intergenic
1156327637 18:36088496-36088518 AAAAAATGGTACACCTGTATAGG - Intergenic
1158941346 18:62408019-62408041 AGAAAATGACCCATCTGTCTTGG + Intergenic
1159618896 18:70614461-70614483 AAAAAATGGTATACCTGTATAGG + Intergenic
1164242696 19:23403865-23403887 AGATAATGGCCTGCCTCTAGTGG - Intergenic
1164675700 19:30099361-30099383 AAATAATGGTATACCTGTATAGG - Intergenic
1168670167 19:58235319-58235341 AAAAAATGGCCCACCTGTATAGG + Intronic
925620052 2:5783355-5783377 ACGAAATGGTCTACCTGTCTAGG - Intergenic
926520277 2:13902132-13902154 AGAAAATGGTATAACGGTATTGG + Intergenic
927383843 2:22510294-22510316 AAAAAATGGTACACCTGTATAGG - Intergenic
928933268 2:36647621-36647643 AAAAAATGGCACACCTGTATAGG - Intergenic
929632002 2:43472920-43472942 AAAAAATGGCACACCTGTCTAGG + Intronic
930066371 2:47330889-47330911 AGAAAAAGGCTTAGCTGTAGCGG + Intergenic
930144603 2:47989059-47989081 TTAAAATGGCACACCTGTATAGG - Intergenic
930553409 2:52865251-52865273 AAAAAATAGTATACCTGTATAGG - Intergenic
930572180 2:53101030-53101052 TAAAAATGGTATACCTGTATAGG + Intergenic
931024772 2:58098467-58098489 TGAAAATGGTATAGCTGTATAGG - Intronic
931423282 2:62147872-62147894 AAAAAATGGTATACCTGTCTAGG - Intergenic
932449979 2:71803323-71803345 ATAAAACAGCCTACCTGCATGGG + Intergenic
933709089 2:85312541-85312563 AAAAGATGGCATAGCTGTATAGG + Intergenic
934968861 2:98746858-98746880 ATAAAATGGTATATCTGTATAGG + Intergenic
935083280 2:99820391-99820413 TGAAAATGGTCCATCTGTATAGG + Intronic
935178126 2:100667183-100667205 AAAAAATGGTCCACCTGTATAGG - Intergenic
935644440 2:105322505-105322527 AAAAAAGGGTCCACCTGTATGGG - Intronic
936072554 2:109380994-109381016 CTAAAATGGACTACCTGTGTTGG + Intronic
936339688 2:111620212-111620234 TAAAAATGGCACACCTGTATAGG - Intergenic
937431158 2:121839795-121839817 AAAAAATGGTCCACCTGTAGAGG - Intergenic
938323569 2:130381997-130382019 AGAAAATGCCCTCCATATATAGG - Intergenic
939235832 2:139491271-139491293 AAACAATGACATACCTGTATAGG + Intergenic
939377986 2:141395279-141395301 AAAAAATGGTATACCTGTATAGG - Intronic
939719953 2:145635989-145636011 AAAAAATGGTATACCTGTATAGG - Intergenic
939786720 2:146523032-146523054 AGAAAATGGCCTTATTGAATAGG - Intergenic
940022977 2:149175369-149175391 AAAAAATGGTACACCTGTATAGG + Intronic
940717395 2:157242691-157242713 AAAAAATGGTATACCTGCATGGG + Intergenic
944034490 2:195277519-195277541 AAAAAATGGTACACCTGTATAGG - Intergenic
944722258 2:202435703-202435725 AAAATATGGTATACCTGTATAGG - Intronic
944813627 2:203352840-203352862 AAAAAATGGTATACCTGCATAGG - Intronic
946385221 2:219380136-219380158 TTAAAATGGTCCACCTGTATAGG - Intronic
947674988 2:231970575-231970597 AAAAAATGGTACACCTGTATAGG + Intronic
948336923 2:237216339-237216361 AAAAAATGGTACACCTGTATAGG - Intergenic
1170659033 20:18318119-18318141 AAAAAATGGTACACCTGTATAGG - Intergenic
1170962620 20:21038892-21038914 AAAAAATGGTACACCTGTATAGG + Intergenic
1175582277 20:60109658-60109680 AGAAAATGGCCCACCTGTATAGG - Intergenic
1177729411 21:25008687-25008709 AAAAAATGGTACACCTGTATAGG - Intergenic
1178151639 21:29801198-29801220 AAAAAATAGCCTGCGTGTATGGG - Intronic
1178605060 21:34029098-34029120 AAAAAATGGTGCACCTGTATAGG + Intergenic
1180133146 21:45840666-45840688 ATAAAATGGCACACCTGTCTAGG - Intronic
1182250553 22:28996826-28996848 AGAACAGGGCTTACCTGGATGGG + Intronic
1182869137 22:33630599-33630621 AAAAAATGGTACACCTGTATAGG + Intronic
949120596 3:379232-379254 AGCAAATGGCCAACCTGTCTCGG + Intronic
950348945 3:12328195-12328217 AGAAAAAGTCCTACCTGGAGCGG + Intronic
950405661 3:12802949-12802971 TTAAAATGGCATGCCTGTATAGG + Intronic
952579098 3:34809778-34809800 GAAAAATGGTATACCTGTATAGG - Intergenic
952603389 3:35112511-35112533 AGAAAATGGCCAACTTATAAGGG - Intergenic
953895629 3:46797453-46797475 AAAAAATGGAAAACCTGTATAGG - Intronic
955325254 3:58005225-58005247 TAAAAATAGTCTACCTGTATGGG - Intergenic
956056576 3:65304934-65304956 TTAAAATGGTCCACCTGTATAGG + Intergenic
958607833 3:96382077-96382099 ACAAAATGGTTTCCCTGTATTGG + Intergenic
959245041 3:103855400-103855422 AAAATATGGTATACCTGTATAGG + Intergenic
959845943 3:111033718-111033740 AAAAAATGGTACACCTGTATAGG - Intergenic
960126908 3:114009091-114009113 AAAAAATGGTACACCTGTATGGG + Intronic
960561828 3:119092758-119092780 AAAAAATGGTATATCTGTATAGG - Intronic
963134951 3:141894117-141894139 AAAAAATGGTATACCTGTATAGG + Intronic
963216186 3:142751281-142751303 AAAAAATGGTATACCTGTACAGG - Intronic
963305326 3:143645330-143645352 AGAAAATAGCTTACATGTATAGG - Intronic
963360309 3:144264152-144264174 AGAAAATAGCATACCAGAATAGG - Intergenic
964279423 3:155047159-155047181 AATAAATGGAATACCTGTATAGG - Intronic
964423180 3:156526051-156526073 ATAAAATGGTATACCTGTGTAGG - Intronic
964662411 3:159135046-159135068 AGAGGATGGCCTCCCTCTATTGG - Intronic
965331875 3:167385357-167385379 AAAAAATGGAATACCTATATAGG + Intergenic
965473535 3:169125359-169125381 ATAAAATGGCTTGCCTGTATGGG - Intronic
965857710 3:173108720-173108742 AAAAAATGGTACACCTGTATAGG - Intronic
966025008 3:175268340-175268362 AAAAACTGGTATACCTGTATAGG + Intronic
966628052 3:182040471-182040493 AAAAAATGGTACACCTGTATAGG + Intergenic
966745614 3:183273664-183273686 AAAAAATGGTACACCTGTATAGG - Intronic
968009834 3:195266870-195266892 AGAAAATGGACTTACTGTATAGG + Intronic
968772243 4:2514822-2514844 AGAACCTGGCCCACCTGTCTTGG + Exonic
970396486 4:15672577-15672599 ATAAAATGGTATACCTGTAAAGG + Intronic
970634880 4:17998152-17998174 ACAAAATAGTATACCTGTATAGG + Intronic
971002019 4:22334127-22334149 AAAAAATGGCATACTTGTATAGG - Intergenic
972001306 4:34038844-34038866 AAAAAATGGTACACCTGTATAGG + Intergenic
972414238 4:38823201-38823223 AAAAAATGGTACACCTGTATAGG - Intronic
972452653 4:39218507-39218529 TTAAAATGGCATGCCTGTATAGG + Intronic
972891166 4:43557833-43557855 AGAAAATGTCCTATCTGTGTAGG - Intergenic
973900924 4:55470228-55470250 AAAAAATGGTATACCTGTATAGG - Intronic
973929025 4:55770659-55770681 TAAAAATGGCACACCTGTATAGG - Intergenic
974340753 4:60612242-60612264 AAAAAATGGTACACCTGTATAGG + Intergenic
974362823 4:60904269-60904291 AAAAAATGGCACACCTGTATAGG - Intergenic
974864994 4:67569247-67569269 AAAAAATGGTATACCTGTATAGG + Intronic
975860230 4:78669331-78669353 AGAAAATGTCCTACCTGGTTAGG + Intergenic
975900866 4:79150656-79150678 ACAAAATGGCAAACCAGTATAGG + Intergenic
976230761 4:82840826-82840848 AAAACATGGTATACCTGTATAGG + Intronic
976898984 4:90149996-90150018 ACAAAATGGGCTAACTGCATGGG + Intronic
977192204 4:94015112-94015134 AAAAAATGGTAGACCTGTATAGG + Intergenic
977437721 4:97020800-97020822 AAAAAATGGTACACCTGTATAGG + Intergenic
977498317 4:97804759-97804781 AAAAAATGGTACACCTGTATAGG - Intronic
978429038 4:108613845-108613867 AGATAATGGTACACCTGTATAGG - Intergenic
978640040 4:110859577-110859599 AAAAAATGGTAAACCTGTATAGG + Intergenic
979393843 4:120161834-120161856 TAAAAATGGTATACCTGTATAGG + Intergenic
980199095 4:129631475-129631497 AAAAAAAGGTATACCTGTATAGG - Intergenic
980224033 4:129957729-129957751 AAAAAATGGCCTAACTACATAGG - Intergenic
981777734 4:148389291-148389313 AGAACTTGGCCTACCTGTGTAGG + Intronic
981943210 4:150309077-150309099 AAAAACTGGCATACCTGTATAGG - Intronic
982174331 4:152691216-152691238 AGAAAATGTCCTTCATGTAGTGG - Intronic
986285791 5:6357825-6357847 AGAAAATGGTTCACCTGTACAGG - Intergenic
988661465 5:33274371-33274393 AAAAAATGGTACACCTGTATAGG + Intergenic
989082031 5:37632910-37632932 AAAAAATGGTATCCCTGTATAGG - Intronic
990813901 5:59761192-59761214 AAAAAATGATATACCTGTATGGG + Intronic
991279940 5:64901486-64901508 AAAAAGTGGTATACCTGTATAGG + Intronic
992823843 5:80527672-80527694 AAAAAATGGCACACCTGTGTAGG + Intronic
994053174 5:95384941-95384963 AAAAAATGACCTACCTGTGTAGG + Intergenic
994299443 5:98129354-98129376 TGAAAATAGTATACCTGTATAGG + Intergenic
994381172 5:99073492-99073514 ATAAAATGGCCAACAGGTATAGG - Intergenic
994788815 5:104198535-104198557 AAAAAATGATATACCTGTATAGG + Intergenic
995354365 5:111222151-111222173 AAAAAATGGTACACCTGTATAGG - Intergenic
995748903 5:115433126-115433148 AGAAAAAGGCATACTAGTATAGG - Intergenic
995900273 5:117057758-117057780 AAAAAATGGTATACCTATATAGG - Intergenic
996420811 5:123259653-123259675 ACAAAATGGTACACCTGTATAGG - Intergenic
996926443 5:128832662-128832684 AAAAAATGGTACACCTGTATAGG - Intronic
997827803 5:137123243-137123265 AGAAAATGTCCTACCAGTCAGGG - Intronic
998121765 5:139584138-139584160 AAAAAATGGCACACCTCTATAGG - Intronic
998791542 5:145771106-145771128 AAAAAAGGGTATACCTGTATAGG - Intronic
998862914 5:146462317-146462339 AAAAAAATGTCTACCTGTATCGG - Intronic
1001225206 5:169938555-169938577 AAAAAATGGTCCACCTGTACAGG + Intronic
1001395157 5:171413775-171413797 AGAAAAGGGCATACCTGTGTAGG + Intergenic
1002702077 5:181131250-181131272 AGAAAATGGCCTGCTTCCATGGG - Intergenic
1003235442 6:4291416-4291438 AAAAAGTGGTCCACCTGTATAGG - Intergenic
1004186074 6:13422340-13422362 AGAAAATGGCGTAGCTGGAGGGG + Intronic
1005463651 6:26091506-26091528 AGAACAGGGCCTACCTGGAGAGG + Exonic
1005776729 6:29140997-29141019 AAAAAATGGTATACCTATATTGG + Intergenic
1006332183 6:33399712-33399734 AAAAAATGGCACACCTGTACAGG + Intronic
1007113323 6:39326314-39326336 AGAGAATGGACTATCTGCATGGG + Intergenic
1007505605 6:42332917-42332939 GGAAACTGGCCTACTTTTATGGG + Intronic
1007559191 6:42792050-42792072 AAAAAATGGTGCACCTGTATAGG + Intronic
1008695783 6:54034900-54034922 AAAAAATGGCACACCTGTATAGG - Intronic
1010588062 6:77679309-77679331 TAAAAATGGTATACCTGTATAGG - Intergenic
1010975165 6:82303872-82303894 AGGAAATGGCCTTCCTGAAAAGG - Intergenic
1011577853 6:88824367-88824389 AAAAAATGGTACACCTGTATAGG + Intronic
1012047474 6:94296488-94296510 ACAAAATGGTACACCTGTATAGG + Intergenic
1012839607 6:104312963-104312985 TAAAAATAGCATACCTGTATAGG + Intergenic
1013992355 6:116268151-116268173 TTAAAATGGTATACCTGTATAGG - Intronic
1014806960 6:125840498-125840520 AAAAAATGATATACCTGTATAGG - Intronic
1015191135 6:130473744-130473766 AAAAAATGGTATACCTGTATAGG + Intergenic
1015608929 6:134992940-134992962 AAAAAATGGTACACCTGTATAGG - Intronic
1015913984 6:138196479-138196501 AAAAAATGGTACACCTGTATAGG + Intronic
1017600943 6:156080631-156080653 AAAATATGGTCCACCTGTATAGG - Intergenic
1018815396 6:167326587-167326609 AGAAAATATCCCACCTTTATTGG - Intronic
1020422145 7:8019816-8019838 AGAAAATGATACACCTGTATAGG + Intronic
1020517641 7:9143267-9143289 GAAAAATGGTATACCTGTATAGG + Intergenic
1020628873 7:10616389-10616411 TAAAAATTGCATACCTGTATAGG + Intergenic
1020740766 7:12014172-12014194 AAAAAATGGTACACCTGTATAGG + Intergenic
1022151932 7:27617139-27617161 AAAAAATGGCACACCTGTATAGG - Intronic
1023156166 7:37254667-37254689 AAAAAATGGCACAACTGTATAGG + Intronic
1024160329 7:46668187-46668209 AGTAAATGGCCAACCTTTCTTGG - Intergenic
1024269454 7:47631505-47631527 AAAAAATGGTCCACCTGGATAGG - Intergenic
1024345315 7:48307447-48307469 ATAAAATGGTATGCCTGTATGGG + Intronic
1024511672 7:50209126-50209148 AAAAGATGGTCTACCTGTTTCGG - Intergenic
1026419974 7:70224744-70224766 AAAAAATGGTACACCTGTATAGG - Intronic
1027341858 7:77217884-77217906 AGAAAAAGACATACCTATATAGG + Intronic
1028256751 7:88608462-88608484 AAAAAATGGCATACCTATATAGG + Intergenic
1028346074 7:89784639-89784661 ATAGAATGGCCTACCTGGTTTGG - Intergenic
1028699359 7:93759290-93759312 AAAAAATGGTACACCTGTATAGG + Intronic
1028786730 7:94803114-94803136 ACAAAATGGTCCACCTGTATAGG - Intergenic
1028878813 7:95855800-95855822 AAAAAATGGTATACCTGTATAGG + Intronic
1030919625 7:115366095-115366117 AAAAAATGGTATACCTCTATAGG - Intergenic
1031428863 7:121640681-121640703 TAAAAATGGTATACCTGTATGGG - Intergenic
1031432707 7:121692337-121692359 AAAAAGTGGCATACCTGTATAGG - Intergenic
1031576877 7:123425253-123425275 AAAAAATGGCACACCAGTATAGG - Intergenic
1032627120 7:133603674-133603696 TGAAAATGGTCCATCTGTATGGG + Intronic
1033379680 7:140802964-140802986 CAAAAATGGTCTACCTGTGTAGG - Intronic
1033480661 7:141737293-141737315 TAAAAATGGCACACCTGTATGGG - Intergenic
1034057496 7:148050744-148050766 AAAGAATGGCACACCTGTATAGG - Intronic
1034373004 7:150616535-150616557 AAAAAATTGTATACCTGTATAGG + Intergenic
1036447464 8:8834445-8834467 AGAAAATGGTGCACTTGTATAGG - Intronic
1036541823 8:9721713-9721735 ATAATATGACCTAACTGTATAGG + Intronic
1037149461 8:15618075-15618097 AAAAAATGGTCCACCTGTCTAGG + Intronic
1037180013 8:15994134-15994156 GAAAAATGGTCCACCTGTATAGG + Intergenic
1037248426 8:16863767-16863789 AAAAGATGGTATACCTGTATAGG - Intergenic
1038834377 8:31102638-31102660 AAAAGATGGTATACCTGTATAGG + Intronic
1040455838 8:47596500-47596522 AAAAAATGGTGCACCTGTATAGG + Intronic
1041069835 8:54116943-54116965 AAAAAATGGTATACCTGTGTAGG + Intergenic
1041141684 8:54827040-54827062 AAAAAATGGTATACCTGTACAGG + Intergenic
1041426927 8:57731924-57731946 AAAAAATGGCACACCTCTATAGG + Intergenic
1041861840 8:62523083-62523105 AAAAAATGGCACACCTGTATAGG - Intronic
1042543489 8:69930258-69930280 AAAAAATGGTACACCTGTATAGG - Intergenic
1043359479 8:79454668-79454690 AGGAACTGGCGCACCTGTATAGG - Intergenic
1043712941 8:83445491-83445513 AGAAAATGCCATAAGTGTATTGG + Intergenic
1043981889 8:86652221-86652243 AAAAAATGGTACACCTGTATAGG + Intronic
1044116533 8:88342832-88342854 AAAAAATGGTAGACCTGTATAGG + Intergenic
1044179419 8:89169986-89170008 AGTAAAGGACCTACCTGTTTAGG - Intergenic
1044414703 8:91924460-91924482 AGAAAAAGGTATACCTGTATAGG - Intergenic
1045765892 8:105668118-105668140 AGCCAATGGCCTATCTGTCTAGG - Intronic
1046691193 8:117286611-117286633 AAAAACTGGCCTACCTAGATGGG - Intergenic
1047391169 8:124452450-124452472 AGAAAATGAAATACCTGTTTGGG + Exonic
1049811413 8:144575128-144575150 AAAAAATGGCACACCTGTACTGG + Intronic
1051075227 9:13225552-13225574 AAAAAATGGTACACCTGTATAGG - Intronic
1051128232 9:13829832-13829854 ATAAAATGGCACACTTGTATAGG + Intergenic
1052168866 9:25368951-25368973 AAAAAATGGCATACCTATGTAGG + Intergenic
1052361776 9:27569409-27569431 AGATAATGGTATACCTGTGTAGG - Intronic
1052550735 9:29944668-29944690 AAAAAATGGTACACCTGTATAGG + Intergenic
1052729625 9:32269889-32269911 AAAATATGGTATACCTGTATAGG - Intergenic
1052953755 9:34235801-34235823 TAAAAATGGTCCACCTGTATAGG - Intronic
1053049573 9:34948463-34948485 AAAAAGTGGTCCACCTGTATAGG - Intergenic
1054852256 9:69859948-69859970 AAAAAATGGTACACCTGTATAGG + Intronic
1055237793 9:74144930-74144952 AAAAAATGGTACACCTGTATAGG + Intergenic
1055247261 9:74261666-74261688 AAAAAATGGTACACCTGTATAGG + Intergenic
1055287856 9:74748962-74748984 AAAAAATGGTACACCTGTATAGG - Intronic
1056961461 9:91127895-91127917 AAAAAATGGTACACCTGTATAGG - Intergenic
1057452513 9:95177308-95177330 AAAAAATGGTACACCTGTATAGG + Intronic
1057709474 9:97426065-97426087 AAAAAATGGCATACCTATATAGG + Intronic
1058329834 9:103746214-103746236 AGAAAATTGCCTTCCTGGATGGG + Intergenic
1058331330 9:103764263-103764285 AAAAAATGGCTTACTTGTTTTGG + Intergenic
1058611651 9:106783356-106783378 AAAAAATGGTATACCTGTATAGG - Intergenic
1058650732 9:107173673-107173695 AAAAAATGGTATAGCTGTATAGG - Intergenic
1059230295 9:112715192-112715214 AAAAAATGGTATACCTGTATAGG + Intronic
1059872314 9:118591610-118591632 AAAAAGTGGTATACCTGTATAGG - Intergenic
1060923957 9:127442454-127442476 AAAAAATGGTACACCTGTATAGG + Intronic
1061623260 9:131825145-131825167 AGAAAATCACCTCCCTGTCTGGG - Intergenic
1186296290 X:8152547-8152569 AAAAAATGGTATACTTGTATAGG + Intergenic
1186791323 X:13002207-13002229 AAAAAATGGTTCACCTGTATAGG - Intergenic
1187080318 X:15979412-15979434 ACAAAATGGTTCACCTGTATAGG - Intergenic
1187080503 X:15981790-15981812 AGAAAATGGCAGACCCATATTGG - Intergenic
1188850014 X:35120480-35120502 AAAAAATGGCACACTTGTATAGG + Intergenic
1189158159 X:38781460-38781482 AAAAAATGGTACACCTGTATAGG + Intergenic
1189563125 X:42211493-42211515 AAAAAATGGCACACCTATATAGG - Intergenic
1193145384 X:78070705-78070727 AAAAAATGGTATACCTGTATAGG + Intronic
1195066919 X:101245453-101245475 AGAATGTGGGCTTCCTGTATAGG + Intronic
1195296394 X:103482271-103482293 ACAAAATGGCACACCTATATAGG + Intergenic
1195501853 X:105611457-105611479 AAAAAATGGTACACCTGTATAGG - Intronic
1195551087 X:106172095-106172117 AAAAAATGGTATACCTGTATAGG + Intronic
1195773895 X:108382188-108382210 AGAAAATGGTATATTTGTATTGG - Intronic
1196082370 X:111646941-111646963 AGAAAATGGTACACCTGTATAGG + Intergenic
1196641431 X:118067273-118067295 AAAAAATGGTACACCTGTATAGG + Intronic
1197230783 X:124001553-124001575 AAAAAATGGTATACCTGTATAGG - Intronic
1199020665 X:142873636-142873658 AAAATATGGCTTAGCTGTATAGG + Intergenic