ID: 1075955190

View in Genome Browser
Species Human (GRCh38)
Location 10:126517518-126517540
Sequence CTCTCCCAATAGCTGGGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075955190_1075955194 -10 Left 1075955190 10:126517518-126517540 CCATACCCCAGCTATTGGGAGAG 0: 1
1: 0
2: 0
3: 5
4: 129
Right 1075955194 10:126517531-126517553 ATTGGGAGAGTGACTGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075955190 Original CRISPR CTCTCCCAATAGCTGGGGTA TGG (reversed) Intronic
900490897 1:2948656-2948678 CTCTCCAGAAAGCTGGGGCAAGG + Intergenic
900683624 1:3932846-3932868 CCCTCACAATAGCTGAGGTCAGG - Intergenic
900931340 1:5739778-5739800 CTCTCCTATTAGCTGGCGAATGG - Intergenic
902091856 1:13909990-13910012 CACTCCCAATAGCTGGCATTTGG + Intergenic
902940637 1:19798373-19798395 CTCCCACAAAAGCTGGGGTCTGG - Intronic
904746878 1:32716791-32716813 CTCTCTCCAGAGCTGGGGGAGGG - Intergenic
908928332 1:69284689-69284711 CTCTGCCAATGGATGTGGTAGGG - Intergenic
909037717 1:70613274-70613296 ATCTCCCCAAAGCTGGGGTTGGG - Intergenic
911885903 1:103299284-103299306 CTATCCTTATAGCTGGGGGAGGG - Intergenic
913335346 1:117704445-117704467 GCCTCCCAAGACCTGGGGTAAGG + Intergenic
919896110 1:202010729-202010751 GTTTCCCAAGAGCTGGGCTAGGG - Exonic
922039834 1:221886182-221886204 CTCTCCCAATCTTGGGGGTAGGG - Intergenic
1065033259 10:21610189-21610211 CTCTACTAAAAGCTGGGGCAGGG + Intronic
1068116650 10:52743689-52743711 CTCTCCCAAAAAATGGGATAAGG - Intergenic
1069874110 10:71551313-71551335 CTCTCCCACTTCCTGGGGGAAGG + Intronic
1070279118 10:75036082-75036104 CTTTCCCAAGAGCTGGAATATGG + Intergenic
1070785559 10:79160310-79160332 CTCTCCCCATGGCTGGGGTGGGG + Intronic
1072382608 10:94890870-94890892 CTTTCCCAAAAGCTTGGGTGTGG - Intergenic
1073443318 10:103565422-103565444 CTCTCTCCATACCTGGGGCAGGG + Intronic
1074443233 10:113497019-113497041 ATCTCCCAGTTGCTGGGGTGGGG + Intergenic
1075746064 10:124728435-124728457 CTCGCCCACGAGGTGGGGTAGGG + Intronic
1075821908 10:125321779-125321801 CTGTCCTAAGTGCTGGGGTATGG - Intergenic
1075955190 10:126517518-126517540 CTCTCCCAATAGCTGGGGTATGG - Intronic
1080679374 11:34459705-34459727 CTCCACCCATAGGTGGGGTAAGG + Intronic
1080858797 11:36135332-36135354 CTTTCCCCATGGCTGGGGTTTGG + Intronic
1081741413 11:45443580-45443602 CTCTCCCAACAGCTGGATTTTGG - Intergenic
1082781921 11:57294656-57294678 CTCTGCCAACATCTGGGGAATGG - Intergenic
1087597056 11:100267560-100267582 CTATCCCAATATCTAGGGGAAGG + Intronic
1088622360 11:111698739-111698761 CTCTCCAAATAGCACTGGTAAGG - Intronic
1088981250 11:114866174-114866196 CTATCCCATTAGCTTGGGTGAGG + Intergenic
1091604455 12:1938054-1938076 CTCTCCCAACAACTGGAGCATGG + Intergenic
1095825911 12:46530755-46530777 CACTCCCAATGGCTGGGCCAGGG + Intergenic
1096736571 12:53660197-53660219 ATCTCCCAACATCTGGAGTAGGG - Intronic
1096755297 12:53794312-53794334 CTTTCCTAATAGATGGGGCAGGG + Intergenic
1097170835 12:57111665-57111687 CTCTGCCAAGGGCTGGGGTTTGG + Intronic
1100321827 12:93502002-93502024 CTCTCCCACTTGTTTGGGTAAGG - Exonic
1104196466 12:126543796-126543818 CCCTCCCAGCAGCTGGGGCAGGG - Intergenic
1105890333 13:24678014-24678036 CTGTCCCAATAGTTGGAGCAGGG + Intergenic
1105948756 13:25211519-25211541 CTCCCCCAGTAGCTGTGGCACGG + Intergenic
1114682818 14:24501164-24501186 CACTCACAACAGCTGGGGAATGG + Intergenic
1115822584 14:37227401-37227423 CTCTCCTCATATCTGGGGTTTGG + Intronic
1124250054 15:28101219-28101241 CTATCCCTGGAGCTGGGGTAGGG - Intergenic
1127733501 15:61820891-61820913 CTCTTCCAATACCTGGGGACAGG + Intergenic
1128725773 15:69987645-69987667 CTCTCTGAATAGCTGAGGAATGG + Intergenic
1129206674 15:74041249-74041271 CTCTCCCACAAGCTGGTGGAGGG - Intronic
1130801570 15:87269200-87269222 CTCCACAAATAGCTGGAGTATGG + Intergenic
1134690586 16:16188743-16188765 CTCTGCAAATGGCAGGGGTAGGG + Intronic
1139272607 16:65698103-65698125 CTGTCCCTATTGCTGGGGAATGG - Intergenic
1142149123 16:88504986-88505008 CTCTGCCATTAGCTGGGGCCAGG + Intronic
1143760394 17:9098674-9098696 CACCCCCAGTAGCTGGGGTGTGG + Intronic
1148072341 17:44915607-44915629 CTCTCCCCATAGCTGGGCTGCGG - Intronic
1148748872 17:49933169-49933191 CTCTCCCCATGTCTGGGTTAGGG + Intergenic
1151319903 17:73346789-73346811 CTCTCCAAAGACCTGGGGGAAGG + Intronic
1151379826 17:73718017-73718039 CTCTCCCATTAGCCTGGGCAGGG + Intergenic
1151697310 17:75724192-75724214 CCCTCCCAATATCTGGGGCCTGG - Intronic
1156205393 18:34880506-34880528 CTGACCCAAAAGCTGGGGGAGGG + Intronic
1157547162 18:48554635-48554657 CTCTCCGAAAAGCTGGTGTTAGG - Intronic
1159413432 18:68111516-68111538 CTCTTCCACTAACTGTGGTAAGG + Intergenic
1160740451 19:683155-683177 CTCTCCCCATAGCTGGTCTGAGG - Exonic
1161849455 19:6731100-6731122 CTCCACCAAGAGCTGGGGGACGG + Exonic
1163321685 19:16578303-16578325 CCCTCCCAAATGCTGGGGTCTGG + Intronic
1164011045 19:21203674-21203696 CTCTCCTAATAGCTGAGGAATGG - Intergenic
1164801070 19:31077231-31077253 CTCTGCCATTAGCTGGGCTTTGG + Intergenic
926321425 2:11750839-11750861 ACCTCCCAATTGCTGGGGTGTGG + Intronic
926700816 2:15802052-15802074 CTCTCCACATAGCTGGGTTCAGG + Intergenic
926958610 2:18330060-18330082 CTCTACCAATAGCCAAGGTAAGG - Intronic
928941954 2:36735406-36735428 AACTGCCAATTGCTGGGGTAGGG + Intronic
931808558 2:65831644-65831666 CACTTCCAATAGCTGTGGTGTGG + Intergenic
935199545 2:100844293-100844315 CTCTCCCAACATCCTGGGTAAGG - Intronic
936829011 2:116618097-116618119 CTGTGGCAATAACTGGGGTATGG - Intergenic
938933399 2:136107188-136107210 TTCCCCCAAGAGCTGGGGTCAGG + Intergenic
940070337 2:149679431-149679453 ATCTCCTCATAGCTGTGGTAAGG - Intergenic
944852927 2:203738456-203738478 CTCTCTCAAGACCTGGGGTGAGG + Exonic
945050123 2:205815881-205815903 CTCTCAACATAGCTGGGATAAGG + Intergenic
948084233 2:235232976-235232998 CTCTCCAAATAGCTGTGAGAGGG - Intergenic
1169033377 20:2430643-2430665 CACTCCCCAGAGCTGGGGGAGGG + Intronic
1173721809 20:45265196-45265218 CTGTGCCCAAAGCTGGGGTAAGG + Intergenic
1174190987 20:48740311-48740333 CACTCCCAGCACCTGGGGTAAGG - Intronic
1174339071 20:49884723-49884745 CTCTCCCTACAGCTGGGGCCTGG - Intronic
1175408207 20:58748799-58748821 CCCTCCCAAGAGCTGTGGTTGGG - Intergenic
1177012189 21:15743219-15743241 CACTCCCAATTGCTGGAATATGG - Intronic
1179671713 21:42954083-42954105 TTTTCCCAATATCTGGGGTGGGG + Intergenic
1184996275 22:48209734-48209756 CTTTCCCAAGATCTGGGGCACGG + Intergenic
950181104 3:10914067-10914089 CTGTCCCACCAGCAGGGGTATGG - Intronic
951365483 3:21776926-21776948 CTCTCCCCATAGCTGCTGAACGG + Intronic
953468923 3:43150239-43150261 GTGACCCAACAGCTGGGGTATGG + Intergenic
954869953 3:53760260-53760282 CTGTCCTAACAGCTGGAGTAGGG - Intronic
959903062 3:111681502-111681524 TTATTCCAATAGCTGGGGGAAGG - Intronic
960041187 3:113151409-113151431 TTATCCCATTTGCTGGGGTAAGG + Intergenic
961080074 3:124019159-124019181 CTCTTCCTATAGCTGGGTTCTGG - Intergenic
961136287 3:124514295-124514317 CTCTTCCATTAGATGGGGTGGGG - Intronic
961514904 3:127426422-127426444 CTCTCCCAGCAGCTGGGGCGTGG - Intergenic
963055951 3:141186423-141186445 CTCTCCCCATTGCTGGGTTTGGG - Intergenic
964180459 3:153877638-153877660 CTTTCCCATTAGCTGGAATATGG - Intergenic
964305633 3:155336496-155336518 CTATCCCAACATCTGGGGAAGGG - Intergenic
967846096 3:194044340-194044362 GTTTCCCAATAACTGGGGAAAGG + Intergenic
969338831 4:6527902-6527924 CTGTCCCAGGAGCTGGGGAAGGG + Intronic
970834528 4:20386672-20386694 CTGTCCCAATATCTGTGCTAAGG - Intronic
971413962 4:26405754-26405776 TGCTTCCGATAGCTGGGGTAGGG + Intronic
980202249 4:129670767-129670789 CACTTCCAACAGCTGGGGTGGGG + Intergenic
980622050 4:135320442-135320464 CACTGCCTAGAGCTGGGGTACGG + Intergenic
980762466 4:137253771-137253793 AACTCCAAATGGCTGGGGTAAGG - Intergenic
981405866 4:144368448-144368470 CTCTTCCAATAAGTGGGGTATGG - Intergenic
984465877 4:180100421-180100443 CTCACCCCAGAGCTGCGGTATGG - Intergenic
985365679 4:189229577-189229599 CACTCACAATAGCTGAGATATGG + Intergenic
988388569 5:30598220-30598242 CTCTACCCATAGCTTGGGTGTGG + Intergenic
990010427 5:50990923-50990945 CTCTCCAAAAAGATGGGGTCCGG + Intergenic
990486417 5:56263469-56263491 CACTTTCAATAGCTGGGGTTTGG - Intergenic
991024064 5:62011046-62011068 CTTCCCCAATAGCTGGGTAATGG - Intergenic
992995769 5:82331267-82331289 CTCTGCCCCAAGCTGGGGTAGGG + Intronic
994807455 5:104468837-104468859 TTCTCCCAAAAGCAGGTGTATGG - Intergenic
996307297 5:122062359-122062381 CTCTACTAATATCTGTGGTAAGG + Intronic
996491963 5:124108290-124108312 CTCTCCCAATAGACTGGGTGAGG - Intergenic
1002394566 5:178942673-178942695 CTCTCCTAATAGCAGGTGTGTGG + Exonic
1004089637 6:12487915-12487937 CTCTTCCAATAGCTCTGGCAAGG + Intergenic
1009677012 6:66838597-66838619 TTCACTCAATAGCTGAGGTAGGG - Intergenic
1012565517 6:100644739-100644761 CCCTCCCAACTGCTGTGGTAAGG + Intronic
1018021049 6:159762406-159762428 CTCTCCCATTGGTTGGCGTAGGG + Intronic
1022800233 7:33769930-33769952 CTCTCCCAAGTGCTAGGGAATGG + Intergenic
1024546855 7:50529597-50529619 CTCTCACAATACCTGGCGCAGGG - Intronic
1026084692 7:67253608-67253630 TTCTTCCAATTCCTGGGGTAGGG + Intergenic
1026692476 7:72561313-72561335 TTCTTCCAATTCCTGGGGTAGGG - Intronic
1030830998 7:114221564-114221586 GTCACCCAATGGCTGGGGGAGGG - Intronic
1030902578 7:115142708-115142730 AACTCCCAGAAGCTGGGGTAGGG + Intergenic
1032054206 7:128671864-128671886 TTCTCCCATGAGATGGGGTAGGG + Intergenic
1034350320 7:150411025-150411047 CTCTGCCAATGTCTGGGGAAGGG - Intronic
1037765060 8:21767630-21767652 CTCTGCCAGTGGCTGGGGTGTGG - Intronic
1039965539 8:42281145-42281167 CTCTCCCGAACGCTGGGGAAGGG + Intronic
1049566826 8:143344608-143344630 CTGTCCCTGTAGCTGGGGAATGG - Intronic
1051455713 9:17255699-17255721 CTCTACCAATAACTGAAGTACGG - Intronic
1053146126 9:35713224-35713246 CTCTCCCAGTAGCTGGGCGATGG + Exonic
1062090814 9:134677934-134677956 GTCGCCCCATAGCTTGGGTATGG + Intronic
1186542044 X:10410733-10410755 CACTTACATTAGCTGGGGTAGGG + Intergenic
1192151654 X:68716553-68716575 CTCTACCCCTAGCTGGGGAAAGG - Intronic
1196888271 X:120267851-120267873 CTCTCCCCATATCAGGGGAATGG + Intronic