ID: 1075956048

View in Genome Browser
Species Human (GRCh38)
Location 10:126524235-126524257
Sequence ATGTGGTCATGAAGGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 5, 3: 36, 4: 372}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075956048_1075956059 30 Left 1075956048 10:126524235-126524257 CCTTCCTCCCTTCATGACCACAT 0: 1
1: 0
2: 5
3: 36
4: 372
Right 1075956059 10:126524288-126524310 GTCTTGTTTTCAGACCATGATGG No data
1075956048_1075956055 -7 Left 1075956048 10:126524235-126524257 CCTTCCTCCCTTCATGACCACAT 0: 1
1: 0
2: 5
3: 36
4: 372
Right 1075956055 10:126524251-126524273 ACCACATGTGCAGAGGGAGGAGG No data
1075956048_1075956057 7 Left 1075956048 10:126524235-126524257 CCTTCCTCCCTTCATGACCACAT 0: 1
1: 0
2: 5
3: 36
4: 372
Right 1075956057 10:126524265-126524287 GGGAGGAGGATATAAGAATGAGG No data
1075956048_1075956058 8 Left 1075956048 10:126524235-126524257 CCTTCCTCCCTTCATGACCACAT 0: 1
1: 0
2: 5
3: 36
4: 372
Right 1075956058 10:126524266-126524288 GGAGGAGGATATAAGAATGAGGG No data
1075956048_1075956054 -10 Left 1075956048 10:126524235-126524257 CCTTCCTCCCTTCATGACCACAT 0: 1
1: 0
2: 5
3: 36
4: 372
Right 1075956054 10:126524248-126524270 ATGACCACATGTGCAGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075956048 Original CRISPR ATGTGGTCATGAAGGGAGGA AGG (reversed) Intronic
900493362 1:2964364-2964386 ATGAGGACATGAAGGAAGGAAGG - Intergenic
900717365 1:4153488-4153510 ATGGGGTCCTCAAGGGAGGTGGG + Intergenic
901071848 1:6524300-6524322 ATGTGATCATGCTGGGAAGATGG + Exonic
902242846 1:15100280-15100302 ATCCGGGCATGAAGGCAGGAAGG + Intronic
902542948 1:17167214-17167236 CTGTGGCCAGGAAGGGAGGGAGG - Intergenic
902607771 1:17578443-17578465 TTGAGGTCAACAAGGGAGGATGG + Intronic
902698550 1:18156245-18156267 AGGTGGTCATCAGGGAAGGAAGG + Intronic
903249642 1:22043451-22043473 ATGTGGGCATAAGTGGAGGAGGG + Intergenic
904137670 1:28326428-28326450 ACGAGGTCAAGATGGGAGGATGG + Intergenic
905309393 1:37038625-37038647 ATGGGGCCATGATGAGAGGAAGG + Intergenic
905408565 1:37753434-37753456 ATGGGGTCAGTCAGGGAGGAAGG + Intronic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
907392470 1:54167209-54167231 ATGTGGTCATGGGGTGGGGAGGG + Intronic
907633442 1:56107523-56107545 ACCTGGTCATGAAGGGAAGGAGG + Intergenic
909712523 1:78668145-78668167 ATGTGGTAATGAAGTGCAGATGG + Intergenic
910021791 1:82599669-82599691 ATGAGGACAAGAAGGAAGGAAGG - Intergenic
910457457 1:87412597-87412619 CCTTGGTCCTGAAGGGAGGAGGG + Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911606453 1:99910967-99910989 ATGGGGAGATGAAGGGAAGAAGG - Intronic
911768883 1:101713901-101713923 AGGTTAACATGAAGGGAGGAAGG + Intergenic
912269813 1:108197843-108197865 ATGTGGCCGTGTTGGGAGGAGGG + Intronic
913940384 1:125098253-125098275 ATGAGGGAAGGAAGGGAGGATGG - Intergenic
915457866 1:156052817-156052839 ATGTGGTTAGGGAGGGAGCAAGG + Intronic
915819684 1:159008917-159008939 ATGTGGTCATGAGTGGAAAAGGG - Intronic
916840205 1:168592642-168592664 ATGTGGGGGTAAAGGGAGGAAGG + Intergenic
916997377 1:170315421-170315443 ATGAGGTCCAGAAGGGAGCAAGG - Intergenic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917243513 1:172974904-172974926 ATGTGGGCCTGTAGGCAGGAGGG - Intergenic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
919072546 1:192774150-192774172 ATTTGCTGATGAAGGGAAGATGG - Intergenic
920214382 1:204351461-204351483 ATATGCTCAGGAAGGGCGGAGGG - Intronic
920653961 1:207860894-207860916 AAGTGGTGATGCAAGGAGGAGGG + Intergenic
921029535 1:211325625-211325647 TTGTGGTCATGGAGAAAGGAGGG - Intergenic
921479281 1:215645184-215645206 TTGTGGGCATGAAGGGAGAAAGG + Intronic
922013170 1:221613236-221613258 AGGTGGTCATGATGGATGGATGG + Intergenic
922351279 1:224736479-224736501 GTGGGGTAAGGAAGGGAGGAAGG + Intronic
922725989 1:227923291-227923313 ATGTGAAGATGAAGGCAGGAGGG + Intronic
923127749 1:231047255-231047277 AGGAGGAAATGAAGGGAGGAAGG - Intergenic
923419348 1:233797308-233797330 ATGAGGTCTTGAAAGGAAGATGG - Intergenic
923612890 1:235511057-235511079 ATGTGCTCAAGGAGGGAGGTTGG + Intergenic
923773168 1:236955539-236955561 ATGCGGTCAGCAAGGGAGCAGGG + Intergenic
924500171 1:244630084-244630106 ATGTGGTCCTGAAGCAAGAAGGG + Intronic
1063030645 10:2231736-2231758 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030660 10:2231792-2231814 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030676 10:2231848-2231870 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030690 10:2231904-2231926 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030706 10:2231960-2231982 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030722 10:2232016-2232038 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030736 10:2232072-2232094 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030767 10:2232184-2232206 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030782 10:2232240-2232262 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030798 10:2232296-2232318 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063030812 10:2232352-2232374 GAGTGGTCATGCAGGTAGGATGG + Intergenic
1063281811 10:4637875-4637897 AAGTAGTCATGTAGGGTGGATGG - Intergenic
1063775697 10:9261227-9261249 ATGTGGGCATGAAGTGAGGAGGG - Intergenic
1064438141 10:15329090-15329112 ATGTGGTGATGTCGGGAAGAAGG + Intronic
1067075755 10:43180729-43180751 ATGTGGTGGTGAAGTGTGGAGGG + Intronic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1069044493 10:63728314-63728336 TTGTAATCATGAAGGGATGATGG - Intergenic
1070338526 10:75475967-75475989 ATGTGGGAAAGAAGGGAGGGCGG - Intronic
1070391571 10:75975370-75975392 ATCTGGTGCTGAAGGGAGAATGG - Intronic
1070639496 10:78157515-78157537 TGGTGGTCAGGAAGGGAGGCAGG + Intergenic
1070763237 10:79038907-79038929 ATGTGGCCATGGTGGGAGGTGGG + Intergenic
1073558569 10:104477857-104477879 ATGTGGGCATGTGGGAAGGATGG + Intergenic
1074340072 10:112619828-112619850 GTGGGATCAGGAAGGGAGGATGG + Intronic
1074730348 10:116366270-116366292 CTGGGGTAATGAAGGGAGTATGG - Intronic
1074770742 10:116731988-116732010 AAGTGGTCCTGCAGAGAGGAGGG + Intronic
1075300931 10:121323484-121323506 GTCTTGTCATGAAGGCAGGATGG + Intergenic
1075956048 10:126524235-126524257 ATGTGGTCATGAAGGGAGGAAGG - Intronic
1076838210 10:133031913-133031935 ATGTGGCCAGGCCGGGAGGATGG - Intergenic
1077078773 11:713356-713378 CTGTGGTGATGAAGGCAGGCAGG - Intronic
1078496051 11:11818110-11818132 ATGTGGTCCTGATGGGAAGATGG + Intergenic
1079088577 11:17464813-17464835 ATCTGGTCTAGGAGGGAGGAGGG - Intronic
1079642822 11:22828618-22828640 GTGTGGTTATCAAGGGAAGAGGG + Intronic
1080452955 11:32393776-32393798 ATGTCGTAATGAGGGAAGGAAGG - Intronic
1080570772 11:33554807-33554829 ATGCTATCAAGAAGGGAGGATGG + Intronic
1082762936 11:57144552-57144574 ATGTGGGCATTAAAGGGGGAAGG - Intergenic
1083236835 11:61356501-61356523 AAGAGGTCAGGAAGGGAGGCGGG - Intronic
1083653785 11:64219499-64219521 AGGTGGTCATGAAGCCAGGGAGG - Intronic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084067885 11:66715802-66715824 CTGTGGTCATGAAGGGAAGTGGG - Intronic
1084376445 11:68781244-68781266 AGGTGGTCATGCACAGAGGAGGG + Intronic
1084800230 11:71538832-71538854 ATGAGGTCAGGAAAGGAAGAGGG - Exonic
1085200308 11:74697803-74697825 AGGAGGGCAGGAAGGGAGGAAGG + Intronic
1086601181 11:88636174-88636196 CTGTGGTCAGGAAAGGAGGTTGG - Intronic
1086618501 11:88854634-88854656 AAGAGGTCAGGAAGGGAGTAAGG + Intronic
1086731830 11:90259561-90259583 ATTTGAGGATGAAGGGAGGAAGG + Intergenic
1087989089 11:104725378-104725400 ATATGGTCACTAATGGAGGAAGG + Intergenic
1088546530 11:110965105-110965127 AAGTGGCCATGAAGGGAGAGAGG + Intergenic
1089095463 11:115916570-115916592 CTGCAGTCATGAAGAGAGGAAGG + Intergenic
1089531484 11:119132705-119132727 ATGTGGTTGCGGAGGGAGGAAGG - Exonic
1090449758 11:126796164-126796186 TAGAGGTCATGAAGGGAAGAAGG + Intronic
1090646165 11:128768223-128768245 TGGTGGTCATGTTGGGAGGAGGG - Exonic
1091317950 11:134628861-134628883 AGGTGGTCATGAAGGAAAGGAGG - Intergenic
1091879526 12:3965662-3965684 TTGTGGTCATGTAGGGATGCAGG - Intergenic
1092237441 12:6818997-6819019 AGGGGGGCAGGAAGGGAGGATGG + Intronic
1092937915 12:13380848-13380870 AGGTGGAGATGGAGGGAGGATGG - Intronic
1093234408 12:16588874-16588896 CTGTTGTTATGAAGGGAGAATGG - Intronic
1094445789 12:30528644-30528666 ATGTGATCATGAAGTCAGGGAGG - Intergenic
1094527892 12:31244901-31244923 CTGTGATCCTAAAGGGAGGAAGG + Intergenic
1095131024 12:38542603-38542625 ATGTGGTTTTGAGGGCAGGATGG - Intergenic
1095240882 12:39857551-39857573 AAATGGTGATGAAGGGAGAAAGG - Intronic
1095241198 12:39860838-39860860 ATGTGTTCATGTAGGGAGACTGG - Intronic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1096334931 12:50747404-50747426 ATCTGCTCATGGAGGAAGGAAGG + Exonic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1096876696 12:54635113-54635135 GTGTGGTGGGGAAGGGAGGAGGG - Intergenic
1097736095 12:63182744-63182766 ATGTGCAAATGAATGGAGGAGGG + Intergenic
1098251799 12:68577833-68577855 AAGTGGTTTTGGAGGGAGGAGGG - Intergenic
1100227353 12:92572665-92572687 ATTTGGGCATGAAGGTGGGAAGG + Intergenic
1100551982 12:95654599-95654621 ATGTGGGGATGATGGGATGATGG + Intergenic
1101837787 12:108307224-108307246 ATGTGGTCAAGAAGGCAGCTGGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102550777 12:113690421-113690443 CTGTGGTCATGAAGCTAGGAGGG - Intergenic
1104380934 12:128307272-128307294 GTGTTATCATGAAGGGAGAAAGG + Intronic
1104763842 12:131313882-131313904 GTGTGGCCATGAAGAGAGAAAGG - Intergenic
1104815654 12:131644174-131644196 CTGTGGCCCTGAAGAGAGGAAGG + Intergenic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105568306 13:21574084-21574106 AGCTGGTCAGGAAGAGAGGAAGG + Intronic
1105896821 13:24723703-24723725 CTGGAGTCATGAAGGGAGGCAGG - Intergenic
1106923327 13:34588188-34588210 GGGAGGTCGTGAAGGGAGGAAGG - Intergenic
1107589160 13:41883407-41883429 ACTAGGTCATGAAGGGAAGATGG - Exonic
1107734231 13:43379420-43379442 ATGTGTTCAAGAAGGCAGAAGGG + Intronic
1108269846 13:48748877-48748899 ATGGTGTCATGAAGGGACCATGG - Intergenic
1109493324 13:63132502-63132524 ATGTGCTCCTGAAGAGAGAAAGG - Intergenic
1109862145 13:68213988-68214010 AAGTGGGGAGGAAGGGAGGAGGG - Intergenic
1110703775 13:78580598-78580620 ATGTGGACATGAAGAGAGTATGG - Intergenic
1111083940 13:83349026-83349048 ATTTGTTTATGAGGGGAGGAAGG + Intergenic
1111198154 13:84899546-84899568 ATATGGACATGAGGGGAGGATGG + Intergenic
1112152970 13:96784286-96784308 ATGTAGCAATGAAGGGAGGAAGG + Intronic
1112394745 13:99019443-99019465 ATGTGGACAGAAAGGGATGAAGG - Intronic
1112728360 13:102330744-102330766 ATGAGGCCATGAAGGGAGGAGGG - Intronic
1112848322 13:103671900-103671922 AAGTGGTCAGGATGGGAGGATGG - Intergenic
1113050997 13:106212017-106212039 ATGTGGACATCAAGGTTGGAGGG - Intergenic
1114684455 14:24514797-24514819 ATGTGGTGGTGAGAGGAGGAAGG + Intergenic
1114744750 14:25135395-25135417 CTGAGTTCATGATGGGAGGATGG + Intergenic
1115324682 14:32126500-32126522 ATGTGGTCATTATTGGAGTAGGG - Intronic
1115427780 14:33280675-33280697 ATGTTGTCAAGAAAGGAAGAAGG + Intronic
1116621029 14:47203359-47203381 TTGTGGTCCTGAAAGGAAGAAGG + Intronic
1117062911 14:51981155-51981177 GAATGGTCCTGAAGGGAGGAAGG + Intergenic
1117207795 14:53462383-53462405 ATGTTCTCCCGAAGGGAGGAAGG + Intergenic
1118540125 14:66814096-66814118 TGGTGGTCAGCAAGGGAGGAGGG - Intronic
1119082801 14:71711859-71711881 ATGTGGCCATTCAGGGAGGGTGG + Intronic
1119378467 14:74213899-74213921 TGGTGTCCATGAAGGGAGGAGGG - Intergenic
1119684837 14:76623352-76623374 ATGTGGAGAAGAAGGGAGGAGGG - Intergenic
1121861608 14:97324079-97324101 GGGTGGCCATGAAGGGAGCAGGG - Intergenic
1122249045 14:100425246-100425268 ATGTGCACATTAAGGGAGGTAGG - Intronic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1123574007 15:21647295-21647317 ATGTGGTCAGGTAGGTAGTATGG - Intergenic
1123610623 15:22089880-22089902 ATGTGGTCAGGTAGGTAGTATGG - Intergenic
1124990129 15:34664932-34664954 ATGTGGTAATGGTGGGAGGTGGG + Intergenic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1128818842 15:70634264-70634286 AAGTGGGGATGAAGGGCGGATGG + Intergenic
1129082796 15:73055098-73055120 AAATGGTCAGCAAGGGAGGAGGG + Intronic
1129176826 15:73846348-73846370 ATGTGGTCATTCAGGGATGGAGG - Intergenic
1129855732 15:78823521-78823543 ATGTCCTTCTGAAGGGAGGAAGG + Intronic
1130108493 15:80946541-80946563 ATGTGGTGATGGAGGAAGGAAGG - Intronic
1132120006 15:99168373-99168395 TTGTGGTCATGGAGGGGGGCTGG - Intronic
1202982872 15_KI270727v1_random:381640-381662 ATGTGGTCAGGTAGGTAGTATGG - Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1132992910 16:2806308-2806330 ATGTGGTCCTGAAGGGTGGGAGG - Intergenic
1133579258 16:7127112-7127134 ATGTGGTCATAAATGGTGGCTGG + Intronic
1134063011 16:11210394-11210416 TTGTGGGCACGAGGGGAGGAAGG - Intergenic
1134201373 16:12202359-12202381 ATGTGGTCCAGAAGTGAGGTTGG + Intronic
1134411394 16:14005270-14005292 AAGTAGTAAGGAAGGGAGGAAGG + Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135723839 16:24839236-24839258 TTGTGCCCAGGAAGGGAGGAGGG + Intergenic
1136186861 16:28593421-28593443 AGGTGGGCTTGATGGGAGGAAGG - Exonic
1137445516 16:48529569-48529591 ATGTGGCCATGGAGGGAGGAGGG - Intergenic
1137464167 16:48692919-48692941 AAGAGCTCATGAATGGAGGAAGG + Intergenic
1137641216 16:50031857-50031879 GTGTTGCCATGGAGGGAGGAAGG + Intronic
1137935233 16:52628739-52628761 GTGTGGTCATGACTAGAGGATGG + Intergenic
1138541946 16:57693676-57693698 ATGAAGGCAGGAAGGGAGGAGGG - Intergenic
1139933785 16:70552109-70552131 ATGGGGCAAAGAAGGGAGGAGGG - Intronic
1139952093 16:70677460-70677482 TTCTGGCCATGAAGGGAGGTGGG + Intronic
1140388221 16:74561253-74561275 TTGTGGTCATGAAGGGTGTGAGG - Intronic
1140771271 16:78205985-78206007 ATGGAGACAGGAAGGGAGGAAGG - Intronic
1141330845 16:83109207-83109229 ATGTGGTCATAAAGAGGGAAGGG + Intronic
1141406313 16:83796854-83796876 ATGTGGTCATCAACTGAGAATGG - Intronic
1143090955 17:4448916-4448938 ATTTGGTCCTGCAGAGAGGAGGG + Intronic
1143742459 17:8964704-8964726 AGGTGGTCCTGAGGGCAGGAAGG + Intronic
1143765524 17:9135142-9135164 ATGGGGTAGAGAAGGGAGGATGG - Intronic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144831960 17:18136793-18136815 AGGGGTCCATGAAGGGAGGATGG - Intronic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146678754 17:34792053-34792075 TTGGGGCCATGAAAGGAGGATGG + Intergenic
1148396686 17:47313670-47313692 AGGTGGTTAGGAAGTGAGGAAGG - Intronic
1148960898 17:51391959-51391981 AGGCAGTCAGGAAGGGAGGATGG + Intergenic
1148961077 17:51393413-51393435 AGGCAGTCAGGAAGGGAGGATGG + Intergenic
1149604874 17:57917387-57917409 ATGTGGTCATCCTGGGACGAAGG + Intronic
1150469497 17:65424795-65424817 ATGTGGCCAGGAAGGCAGCAGGG - Intergenic
1151336785 17:73444578-73444600 ATGAGGTGATTCAGGGAGGATGG - Intronic
1151574919 17:74948193-74948215 ATTTGGACAGGAAGGTAGGAGGG + Intronic
1152621251 17:81366022-81366044 CTGTGGCCATGAAGGCGGGAGGG - Intergenic
1152846577 17:82603695-82603717 AAATGGTAAAGAAGGGAGGAGGG + Exonic
1155878863 18:31119112-31119134 AGGTGGGCATGAGGGAAGGAAGG + Intergenic
1156609711 18:38712002-38712024 ATATGGTCATGTTGGAAGGATGG + Intergenic
1157874190 18:51256640-51256662 ATGTGGTGGTGGGGGGAGGAGGG + Intergenic
1159456799 18:68669471-68669493 ATGTGGTAATGGTGGGAGGCAGG + Intergenic
1159705490 18:71680591-71680613 ATTTAGTCTAGAAGGGAGGAAGG + Intergenic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161258362 19:3322108-3322130 ATGGGGACATGGAAGGAGGAGGG + Intergenic
1161396983 19:4049895-4049917 AGGTGGTGATGACAGGAGGATGG - Intronic
1164749056 19:30637645-30637667 ATGTGATCATCAAGGGTAGAAGG - Intronic
1164785486 19:30927118-30927140 ATGTTGGCATGAAGGAAGCAGGG - Intergenic
1165135077 19:33662676-33662698 AGGAGGTGGTGAAGGGAGGAGGG + Intronic
1165386317 19:35512536-35512558 ATGTGGGCTTGGAGGGAGGGAGG + Intronic
1165934921 19:39383476-39383498 CTGTGGTAAGAAAGGGAGGAAGG - Intronic
1167706251 19:51082853-51082875 ATGTCTTGATGAAGGAAGGAGGG + Exonic
1168296489 19:55379504-55379526 ATGGGGGCATGCAGGGATGAAGG - Intronic
1168525113 19:57082392-57082414 ATGCAGTCAGGAAGAGAGGAAGG + Intergenic
925582628 2:5426854-5426876 AATTGGTCATGAAGGAAGGAAGG - Intergenic
925984009 2:9200575-9200597 ATGTGCACAGGCAGGGAGGAAGG + Intergenic
927241520 2:20923584-20923606 ATGTGTTCTTGAAGGTATGAGGG - Intergenic
928274077 2:29883020-29883042 ATTTTTTCATGAAGGAAGGAAGG + Intronic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
932334470 2:70922277-70922299 AAGTGGAGAGGAAGGGAGGAGGG + Intronic
933008653 2:77028401-77028423 GTGTGTTAATGAAGTGAGGAAGG - Intronic
933779307 2:85790543-85790565 ATGTGGCCATGGAGACAGGAAGG - Intergenic
933906755 2:86901750-86901772 ATGTGCTCTTAAAGGGAGAAAGG + Intergenic
934024720 2:87991884-87991906 ATGTGCTCTTAAAGGGAGAAAGG - Intergenic
934802708 2:97182076-97182098 ATGTTTTCACCAAGGGAGGAAGG + Intronic
934833491 2:97558494-97558516 ATGTTTTCACCAAGGGAGGAAGG - Intronic
935775794 2:106469960-106469982 ATGTGCTCTTAAAGGGAGAAAGG - Intergenic
935840032 2:107098941-107098963 ATGTGGTCATTTAGGTAGCACGG + Intergenic
937253989 2:120541763-120541785 CTGTGCTCATTAAGGCAGGAAGG + Intergenic
937263177 2:120599275-120599297 ATGTGGGCGTGAAGGCAGGAGGG + Intergenic
938928276 2:136064083-136064105 AGGTGGTCCTGAAGGGACGAGGG + Intergenic
939201430 2:139040803-139040825 CTGTGATCATGAAGAGAGAATGG + Intergenic
940667406 2:156625590-156625612 ATGTGGGGAGGTAGGGAGGAAGG + Intergenic
942186486 2:173429251-173429273 ATGTGGGAACGAAGGAAGGAAGG - Intergenic
948594011 2:239068003-239068025 ATGCTGTCAGGATGGGAGGAGGG - Intronic
1168968117 20:1912456-1912478 ATGCGGTAATGAATGAAGGAAGG - Intronic
1169064845 20:2689364-2689386 AAGGGGTGATGAAGGGAGGAAGG - Intergenic
1169112213 20:3041593-3041615 GTGTGGGAATGAAGTGAGGAAGG - Intergenic
1169471078 20:5886111-5886133 ATGTGGTCATGAAGGCAGGCAGG - Intergenic
1169719186 20:8654653-8654675 ATGTGGTCAGGAAGGGTTCACGG + Intronic
1169898151 20:10526097-10526119 ATGTGCGCATGAAGGAAGGAGGG - Intronic
1170184205 20:13569507-13569529 TTGTGGTCATGATGTTAGGAGGG + Exonic
1171182256 20:23099350-23099372 ATGTGGACATGAAAATAGGAAGG - Intergenic
1172283673 20:33726002-33726024 AAGGGGTCAAGCAGGGAGGAGGG - Intergenic
1172791771 20:37510784-37510806 CTGTAGTCATGAGGGGAAGAAGG - Intronic
1173531126 20:43770494-43770516 AGGGAGTCAGGAAGGGAGGAAGG - Intergenic
1175326199 20:58130009-58130031 ATGTGGTCATGGAGGCAACAGGG - Intergenic
1175984034 20:62755356-62755378 ATGGAGGGATGAAGGGAGGAAGG - Intronic
1176126638 20:63478473-63478495 GTGTGCCCAGGAAGGGAGGACGG - Intergenic
1177295410 21:19166966-19166988 ATGTGGCAATGAAGAGAAGATGG + Intergenic
1177572670 21:22907495-22907517 AAGTGGTCAAGAAGAGAGGAAGG + Intergenic
1178709485 21:34902259-34902281 ATTGGTTCTTGAAGGGAGGAGGG + Intronic
1178994666 21:37388038-37388060 AGGAGGTCATGAAGGGAAGAGGG - Intronic
1179343788 21:40537265-40537287 ATGTGGTGAGGAAGGGAGGTAGG + Intronic
1181459426 22:23077594-23077616 GTGGGGTCAGCAAGGGAGGAGGG + Intronic
1181629244 22:24141926-24141948 ATGTGGTCTGGTAGGGAGGAAGG + Intronic
1181726351 22:24813751-24813773 ATGTGGTGAGGATGGCAGGAGGG + Intronic
1181884748 22:26011398-26011420 ATGAGAACATGAAGGGAGGAGGG + Intronic
1181915532 22:26276790-26276812 AGGTGGTTATGAAGGAGGGAAGG + Intronic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
950705036 3:14774329-14774351 TTGTGCTCAGGAGGGGAGGAGGG - Intergenic
950881735 3:16328016-16328038 ATGTGGGCATACAGGGTGGAAGG - Intronic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
953038558 3:39234598-39234620 AGGGGGTCCTGAAGGGAGGAAGG + Intergenic
953132466 3:40153455-40153477 GTGTAGTCATGAATTGAGGATGG - Intronic
956080210 3:65549334-65549356 AGGGGGTTAGGAAGGGAGGAAGG - Intronic
956339295 3:68203953-68203975 ATGTGGTCATGGGGGGTGGGGGG - Intronic
956387830 3:68739623-68739645 ATGTGTCCATCAATGGAGGACGG + Intronic
957224558 3:77426671-77426693 ATTTGGTCAGGAAGGAAGGAAGG + Intronic
958876281 3:99621408-99621430 AGGTGGTCAGGAAGGCAGGTGGG - Intergenic
958906850 3:99951223-99951245 ATGTGGTTATGAAGTCAGGGAGG - Intronic
959311189 3:104739944-104739966 ATGTGCTCAAGAATGCAGGAAGG - Intergenic
959349955 3:105249614-105249636 ATGTGGTCATTTTGGGAGGGGGG - Intergenic
959496868 3:107061767-107061789 ATGTGCACATGATGGAAGGAGGG - Intergenic
961435497 3:126913690-126913712 ATGTGGACATGTAGGCAGCAGGG - Intronic
962694278 3:137932197-137932219 ATTTGGACAGGAAAGGAGGATGG + Intergenic
963624355 3:147652177-147652199 ATGTGATAATGTAGTGAGGAGGG - Intergenic
964151273 3:153527523-153527545 AGGTAGGCATTAAGGGAGGATGG + Intergenic
964473351 3:157077109-157077131 AGGTGGTCTACAAGGGAGGAAGG + Intergenic
964644939 3:158948882-158948904 AAATGGGCATGATGGGAGGAAGG - Intergenic
965509728 3:169555192-169555214 ATGAAGACATGAAGGAAGGAAGG - Intronic
965913894 3:173817100-173817122 ATGTGGTCATAAAGCGGAGAAGG + Intronic
966326611 3:178763059-178763081 ATGAGGTCATCTAGGAAGGAAGG + Intronic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
967315462 3:188148594-188148616 ATTTGATCATGAAATGAGGAAGG + Intergenic
967982391 3:195073478-195073500 TTGTGGGCATGAGGGGGGGAGGG - Intronic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968894392 4:3390191-3390213 AGGTGGTCAGGAAGGGAAGAGGG - Intronic
969412859 4:7041265-7041287 ATCTGGTCAAGAAGGGAGAAAGG + Exonic
971045024 4:22796518-22796540 AGGAGGTGATGAAGGTAGGAGGG + Intergenic
972248050 4:37267086-37267108 ATGTGGTCATAAAGGGAAGAAGG + Intronic
972451217 4:39200566-39200588 ATGTGGCAAGGAAGTGAGGAAGG - Intronic
974081374 4:57216843-57216865 ATCAGGTCATGAAGACAGGACGG + Intergenic
974913743 4:68154213-68154235 ATGTTGTCATGAATGAATGAAGG - Intergenic
975437623 4:74371775-74371797 ATTTGGGCATGAAGGCATGAAGG - Intronic
976300632 4:83512500-83512522 ATGTGGTCCTGAAGAGATGTGGG + Intronic
977434891 4:96981664-96981686 ATGGGGTCAGGTAGGGAGGCAGG + Intergenic
977784581 4:101017984-101018006 ATGTGGTATTGATGGAAGGATGG - Intergenic
980027861 4:127787443-127787465 ATGTGGTTGGGAAGGGATGAAGG - Intronic
981202375 4:141995773-141995795 ATGTTGCTGTGAAGGGAGGAGGG - Intergenic
981643796 4:146974978-146975000 ATGTGGTGGGGAAGGGAGGAGGG - Intergenic
984335847 4:178389178-178389200 AAGTGATGATGAAGGGAGGAAGG + Intergenic
985651381 5:1109280-1109302 ATGTGGTCACGGAGGAAGGGTGG + Intronic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987940131 5:24523089-24523111 ATGGGGGCAGGAAGGGAGGGTGG + Intronic
989645183 5:43623197-43623219 ATGTGGGCATGATGGGTGGGTGG + Intronic
990278297 5:54223170-54223192 GTGTTCTCATGAAAGGAGGAGGG - Intronic
991208129 5:64073484-64073506 CATTGGACATGAAGGGAGGAAGG - Intergenic
992225221 5:74613849-74613871 ATTTGGTCATGGATGGAGCAGGG - Intergenic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
993488434 5:88515554-88515576 ATGTGGTGATAATGGGAGGTGGG - Intergenic
995611321 5:113913323-113913345 ATGTGGTCTAGAAGGAAGGAGGG + Intergenic
996705791 5:126497162-126497184 ATGTGGTAATGAAAAGTGGAAGG + Intergenic
998847845 5:146328112-146328134 ATGTGGTCTAACAGGGAGGAGGG + Intronic
999004187 5:147957828-147957850 AAATGGTCATAAAGGGATGAGGG - Intergenic
1001781270 5:174371037-174371059 ATGTGATCCTGAAGGGAGAGAGG - Intergenic
1002302573 5:178265745-178265767 GTGTGGTCAGAAAGGCAGGAAGG + Intronic
1003295048 6:4818906-4818928 CTGTGGTCTTAAAGGCAGGAAGG - Intronic
1003501326 6:6705371-6705393 ATGTGGTTATGAAACCAGGAGGG - Intergenic
1003973158 6:11318218-11318240 ATGTGATCATGGAGGCAGGCAGG - Intronic
1004024666 6:11806853-11806875 CAGTGGTCAGGCAGGGAGGAAGG + Intronic
1004305543 6:14498657-14498679 AAGTGGGAAGGAAGGGAGGAAGG - Intergenic
1005097293 6:22131320-22131342 ATGGAGTCATGAAGGAAGGCAGG + Intergenic
1005143630 6:22662822-22662844 ATGTGGAGAGGAAGAGAGGAAGG + Intergenic
1006919378 6:37617383-37617405 ATTTGGTGAGGAAGGAAGGAAGG - Intergenic
1006977555 6:38117462-38117484 ATGTGGTCAAGAAGAGAGAAAGG - Intronic
1007515813 6:42410633-42410655 ATGTGGTGATGGAGGGAGGGGGG - Intronic
1008067082 6:47061445-47061467 ATGTGGTCCTGAGTGTAGGAGGG + Intergenic
1008072350 6:47110428-47110450 ACTTGGTCATGAAGGCTGGAGGG - Intergenic
1008074686 6:47133353-47133375 ATGTGGTCTAGAAGTGAGAATGG + Intergenic
1008385109 6:50880333-50880355 AAGGGGACAGGAAGGGAGGAGGG - Intergenic
1010042770 6:71406228-71406250 ATGTGGACATGAGAGGAGAAGGG - Intergenic
1011034044 6:82954072-82954094 ATGAGGTCAGAAAGGGAGGCAGG + Intronic
1011157731 6:84352026-84352048 CTGTGGAAAGGAAGGGAGGAAGG + Intergenic
1011819388 6:91233195-91233217 ATGTGGTCATGAGGGAGGGTTGG - Intergenic
1013983855 6:116166037-116166059 CTGGGGTCATGAAGGTAGAAAGG + Intronic
1014412726 6:121146965-121146987 ATAGGGTGATGGAGGGAGGAAGG - Intronic
1014682350 6:124447395-124447417 ATGTTTTCATGAAAGAAGGATGG + Intronic
1016428063 6:143955472-143955494 ATGTGGAGATGCAGTGAGGAGGG + Intronic
1018630152 6:165815467-165815489 ATGGGGTAACGAAGGGTGGAAGG + Intronic
1018928867 6:168226435-168226457 ATGAGGTCCAGAAGAGAGGAGGG + Intergenic
1018972872 6:168540658-168540680 ATGTTGTCCTGATGAGAGGATGG + Intronic
1019117152 6:169774425-169774447 AGGTGGGCAGGTAGGGAGGAGGG + Intronic
1019266765 7:121526-121548 AGGTGGAGAGGAAGGGAGGAGGG + Intergenic
1019480702 7:1265377-1265399 ATGTGGTCAGGGAGGGCGGCAGG + Intergenic
1019548658 7:1591408-1591430 AGGTGGTCCTGCAGGGAGAAGGG - Intergenic
1020363368 7:7353664-7353686 ATGTGGTCAGTCAGGGAAGAAGG + Intergenic
1021494004 7:21252450-21252472 ATGGAGTGATGAAGGGAGGTTGG + Intergenic
1022500016 7:30876938-30876960 ATGTGGTCATGTGGGAAGGGTGG - Intronic
1023305549 7:38822567-38822589 AAGTGGTCATCAATGGAAGATGG - Intronic
1023989789 7:45121882-45121904 ATGTGTACAGGAAGAGAGGAAGG - Intergenic
1025234868 7:57227745-57227767 AGGTTGTCGTGAAGGAAGGAGGG + Intergenic
1026136820 7:67670643-67670665 ATGTGGTTTGAAAGGGAGGAGGG + Intergenic
1026464308 7:70640863-70640885 ATATGGGCAAGAAGGGATGACGG - Intronic
1028120290 7:87049849-87049871 ATGTGGTGATGTTGGGAGGTGGG + Intronic
1028776264 7:94680619-94680641 ATTTGGTGCTGAAGGGATGATGG + Intergenic
1028865893 7:95711043-95711065 ATGTGGTAGTGAAGTGTGGAAGG - Intergenic
1029788406 7:102816758-102816780 ATGTGGGGAGGCAGGGAGGATGG - Intronic
1030385102 7:108858482-108858504 AGGTGGTCATGAAGACAGAATGG - Intergenic
1034207300 7:149329085-149329107 ATGTGGTCCTTAAGGGAGCAAGG - Intergenic
1034575218 7:151990831-151990853 ATGTGGTCATTCAGGGATGCAGG - Intronic
1035796360 8:2360875-2360897 ATGTGGGGAGGAAGGAAGGATGG + Intergenic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036702584 8:11022961-11022983 CTGTGGCCAGGAAGGGAGGGAGG - Intronic
1038064957 8:23954307-23954329 ATGTGGTCAGGAATAGAGCATGG - Intergenic
1039010805 8:33090751-33090773 GTGTGGGCATGAAGGGATAAGGG + Intergenic
1039070923 8:33648626-33648648 GTGTGATCATGTTGGGAGGATGG + Intergenic
1040012428 8:42673340-42673362 ATGAGGCCATGAAGGGAGTTTGG - Intergenic
1041195308 8:55396062-55396084 AGGTGGTCAGGACGTGAGGAAGG - Intronic
1042551593 8:69998986-69999008 ATGTGTTCATCAGGGCAGGAGGG - Intergenic
1042998848 8:74732732-74732754 ATGTGACTATCAAGGGAGGAGGG + Intronic
1045658008 8:104406651-104406673 AAGTGGTCAGGAAGGGAAGATGG - Intronic
1047366907 8:124219881-124219903 ATGTGGTTTGGAAGAGAGGAGGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1049611011 8:143555330-143555352 ATGTGGCGGTGAAGGGTGGAGGG + Intronic
1049632659 8:143666974-143666996 ATGTGCACATGGAGGAAGGAGGG - Intergenic
1049737227 8:144215514-144215536 AAGTGGTCCTCTAGGGAGGAGGG - Intronic
1051206890 9:14697472-14697494 ATGCTGTCATGAGGGGATGATGG - Intergenic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1052457454 9:28718524-28718546 ATGTTGTGATGAAGGGGAGAAGG - Intergenic
1053228376 9:36382304-36382326 AAGAGGTCATAATGGGAGGAAGG + Intronic
1053472655 9:38357963-38357985 GTGTGGTTATGAAGGTGGGAGGG + Intergenic
1054751613 9:68912849-68912871 CTTTAGTCATGAAGAGAGGATGG + Intronic
1055357066 9:75448550-75448572 TTGAGGTTATGAAGGGAGAAAGG + Intergenic
1056209957 9:84356276-84356298 ATGGGTTAATGATGGGAGGAGGG - Intergenic
1059409664 9:114124149-114124171 ATGGGGTGCTGAAGGGAGGGTGG - Intergenic
1059716665 9:116919579-116919601 CTGTGGTCATCAGAGGAGGAGGG - Intronic
1060557672 9:124517462-124517484 ATTTGGTCATGGAGGGTTGATGG + Exonic
1061659354 9:132118380-132118402 CTGTTGTTATGAAGGGAAGATGG - Intergenic
1188172052 X:26939533-26939555 ATCTGCTCAGGAAAGGAGGAGGG - Intergenic
1188447629 X:30272842-30272864 AGGGGGTCATGAAGGAAAGATGG + Intergenic
1190014721 X:46817133-46817155 CTGTGGACAGGAAGGCAGGAAGG + Intergenic
1190556812 X:51644121-51644143 ATGGGGTTGTGAGGGGAGGATGG - Intergenic
1190748218 X:53339246-53339268 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1190798894 X:53770454-53770476 ATCTGGTCAGGGTGGGAGGATGG + Intergenic
1191786873 X:64925635-64925657 AAGTAGGCATGGAGGGAGGAGGG - Intronic
1192033327 X:67538326-67538348 ATTTGGTCATGAAGGAAGAGAGG + Intergenic
1192059867 X:67812804-67812826 ATCTGGTCTTGAGTGGAGGAGGG + Intergenic
1192176406 X:68888641-68888663 ATGTGGTCAGAGAGGGAGGCAGG + Intergenic
1192626854 X:72737895-72737917 ATCTTGGGATGAAGGGAGGATGG - Intergenic
1195960707 X:110383304-110383326 AGGAGTTCTTGAAGGGAGGAGGG - Intronic
1196585965 X:117428384-117428406 ATGTGGGGATGAAGAGAGAAAGG - Intergenic
1197553581 X:127926015-127926037 AGGGGGTCATGAAGAGAGGTTGG + Intergenic
1197886043 X:131219536-131219558 GGGTGGTCAGGAAGGGAGTAGGG + Intergenic
1198282196 X:135153415-135153437 ATGTGATCATATATGGAGGAGGG - Intergenic
1198288763 X:135219107-135219129 ATGTGATCATATATGGAGGAGGG + Intergenic
1198329555 X:135609349-135609371 ATATTGTCATCAAGGGAAGAAGG + Intergenic
1198329635 X:135610122-135610144 ATAGTGTCATGAAGGGAAGAAGG + Intergenic
1198337009 X:135676222-135676244 ATGGTGTCATGAAGGGGAGAAGG - Intergenic
1198337124 X:135677395-135677417 ATGGTGTCATAAAGGGAAGAAGG - Intergenic
1198362043 X:135905055-135905077 ATAATGTCATGAAGGGAAGAAGG + Intronic
1198362267 X:135907117-135907139 ATATTGTCATGAAGGGGAGATGG + Intronic
1198362421 X:135908668-135908690 ATAGTGTCATGAAGGGAAGAAGG + Intronic
1198499235 X:137226205-137226227 AAGTGGCCAGGAAGGGAAGAAGG - Intergenic
1198720931 X:139619326-139619348 ATGTTGTTATGATGGGAGGAAGG + Intronic
1199693367 X:150326148-150326170 ATGTGGTGGTGGAAGGAGGAGGG - Intergenic