ID: 1075959233

View in Genome Browser
Species Human (GRCh38)
Location 10:126552987-126553009
Sequence TTGTGTTTATGATGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075959233_1075959237 15 Left 1075959233 10:126552987-126553009 CCTGCTTCCCATCATAAACACAA No data
Right 1075959237 10:126553025-126553047 ATAATAGACCTAACTAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075959233 Original CRISPR TTGTGTTTATGATGGGAAGC AGG (reversed) Intronic
No off target data available for this crispr