ID: 1075960990

View in Genome Browser
Species Human (GRCh38)
Location 10:126567608-126567630
Sequence AGCCCTGGAAGGTGACCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075960978_1075960990 26 Left 1075960978 10:126567559-126567581 CCCACAGCTGGGTTGGCTGAAGG 0: 1
1: 0
2: 0
3: 17
4: 167
Right 1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG No data
1075960986_1075960990 -4 Left 1075960986 10:126567589-126567611 CCAGCAAAGCAGGGTCGGAAGCC 0: 1
1: 0
2: 0
3: 5
4: 93
Right 1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG No data
1075960980_1075960990 25 Left 1075960980 10:126567560-126567582 CCACAGCTGGGTTGGCTGAAGGA 0: 1
1: 0
2: 1
3: 25
4: 241
Right 1075960990 10:126567608-126567630 AGCCCTGGAAGGTGACCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075960990 Original CRISPR AGCCCTGGAAGGTGACCTGG AGG Intronic
No off target data available for this crispr