ID: 1075965090

View in Genome Browser
Species Human (GRCh38)
Location 10:126604264-126604286
Sequence CAGGTGATGCTGGTTTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 1, 2: 0, 3: 27, 4: 217}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075965090 Original CRISPR CAGGTGATGCTGGTTTCCCC TGG (reversed) Intronic
900253220 1:1682658-1682680 AAGGTGCTGTTGCTTTCCCCTGG - Intronic
900570909 1:3357749-3357771 CAGGTGTTGCCAGTGTCCCCTGG - Intronic
902919295 1:19656863-19656885 CAGGTGACGCTGGAGTGCCCGGG + Exonic
903316900 1:22515189-22515211 CAGGTAAAGCTCGTTTCCACCGG - Intronic
903361068 1:22777631-22777653 CATCTGATGCTGCTTTCCCTGGG - Intronic
903580812 1:24369281-24369303 CCTGTGATGCTGGATTCCCCTGG - Intronic
905235628 1:36544544-36544566 CAGGGGATGCTGGAGACCCCGGG + Intergenic
906265985 1:44430162-44430184 CTGTTAATGCTAGTTTCCCCTGG + Intronic
906388682 1:45394568-45394590 CAGGTGATGCTGATGTCGCTTGG + Intronic
907474278 1:54695268-54695290 CAGGTGATCCTGGCTTACCCAGG + Intronic
907520187 1:55018675-55018697 CAGGTGGTGCTGATGTCCCGTGG + Intergenic
907556453 1:55348598-55348620 CAGGTGTTGTTGGCTTCTCCTGG + Intergenic
911542016 1:99168104-99168126 GAGGTGATGATGGCTTCTCCTGG + Intergenic
912980235 1:114364799-114364821 CAGGTGCTGCGGGTTTCACATGG + Intergenic
913387690 1:118277751-118277773 CTAGTGCTTCTGGTTTCCCCAGG + Intergenic
915455220 1:156035993-156036015 CAGGTCTTGCTTGTGTCCCCAGG - Exonic
916601893 1:166301160-166301182 AGGGTGATCCTGGTTTACCCAGG + Intergenic
917634294 1:176919901-176919923 CCTATTATGCTGGTTTCCCCTGG + Intronic
918754052 1:188313640-188313662 AAGGTGATGCCGTTTTCACCTGG + Intergenic
920007667 1:202845208-202845230 CTGTTGATGCTGGCTTCACCGGG - Intergenic
920051729 1:203168427-203168449 CAGGCGATGCCGGTGTCTCCTGG - Intronic
920665296 1:207959108-207959130 CAAGAGATGCTGGCTTCCCCCGG - Intergenic
920799567 1:209173945-209173967 CAGGGGGTGCTGGGTGCCCCAGG - Intergenic
921153931 1:212423635-212423657 CAGGTGGGGCTGGGTTCCTCAGG - Intergenic
924587356 1:245371615-245371637 CATGTGACGCAGATTTCCCCAGG - Intronic
1063133845 10:3199773-3199795 CAGGTGCTGCTGGCTGCTCCTGG + Intergenic
1063655711 10:7986311-7986333 GAGGTGCTGCTGGTTCACCCAGG - Intronic
1065476573 10:26144775-26144797 CAGGTGATGCTGATGTTCCTGGG - Intronic
1065532951 10:26690832-26690854 TTGGTGATGCTGGTTTGCTCAGG - Intergenic
1065742389 10:28808769-28808791 CAGATAATGATGGTTACCCCAGG + Intergenic
1066188106 10:33030368-33030390 CAGGTGAGGCTGTTTTCAGCAGG + Intergenic
1067138075 10:43629371-43629393 CAGGTGATGCTGATGTCCTCAGG + Intergenic
1068914393 10:62412937-62412959 TAGCTGATGCTGGTCTTCCCAGG + Intronic
1070662916 10:78320349-78320371 CAGGTGAAGTAGGTTTGCCCCGG + Intergenic
1073728892 10:106267942-106267964 CAGATGATGCAGGTTTTTCCTGG - Intergenic
1073859466 10:107721165-107721187 CAGGTGCTGCTGTTTCCCCCAGG + Intergenic
1075965090 10:126604264-126604286 CAGGTGATGCTGGTTTCCCCTGG - Intronic
1076214596 10:128682831-128682853 TAGGAGATGATGGTTCCCCCCGG - Intergenic
1076846550 10:133072099-133072121 CAGGTGAGGCTGGTGGCGCCAGG + Intronic
1078396037 11:10982983-10983005 CAGGGGCTGCTGGATTCTCCAGG + Intergenic
1080608594 11:33885198-33885220 CAGGTGAAGCAGGTTCCCTCTGG + Intronic
1080925932 11:36755833-36755855 CACCTCATGCTGGTTTGCCCAGG - Intergenic
1081473499 11:43400440-43400462 CAGGTGATGCTTGTTGCCGCAGG + Intronic
1083656618 11:64232863-64232885 CAGGTGATGCCTGTTCTCCCCGG + Exonic
1084682920 11:70677555-70677577 AAGGTAAGGCTGGTTGCCCCTGG + Intronic
1085239963 11:75044957-75044979 CAGGTGCTGCGGGTTTCACGCGG - Intergenic
1087019657 11:93589496-93589518 CAGGTGGGGCTGATTTCCCTGGG - Intergenic
1088957472 11:114625071-114625093 CAGGTAATGGTGGTTACCCACGG - Intergenic
1088984681 11:114895180-114895202 CAGGTGATGGATTTTTCCCCTGG + Intergenic
1089792662 11:120955912-120955934 CAGATGATGCTGGTGCCACCGGG - Intronic
1090496826 11:127221248-127221270 CAGGTGATGGTGGTTTTCTGTGG + Intergenic
1091640795 12:2235608-2235630 TGGGTGATGCCGGTTTACCCAGG + Intronic
1092124115 12:6063903-6063925 CAGGTGGTTCTGGTTTGCTCTGG - Intronic
1094496320 12:30991648-30991670 CAGGTGATGGTGGTGTGCCTGGG - Intronic
1094852108 12:34386910-34386932 CAGGGGACGCTGATGTCCCCTGG - Intergenic
1094871640 12:34602207-34602229 CAGGGGATCCTGGGTTTCCCTGG + Intergenic
1097839135 12:64304158-64304180 CAAGTGATACTGGTTTTCCCTGG - Intronic
1097885421 12:64724238-64724260 CAGGTGATGCTGCTTGTCCTGGG - Intronic
1098226723 12:68332208-68332230 AAGGTGAGGCTGGGGTCCCCGGG - Exonic
1100391918 12:94150869-94150891 CAAGCGATACAGGTTTCCCCTGG + Intronic
1101524076 12:105511682-105511704 CATGTGCTGCTGCTTGCCCCTGG + Intergenic
1103734062 12:123047715-123047737 CATGTGATGCCTGTCTCCCCTGG - Intronic
1104762013 12:131302652-131302674 GAGGTGCAGCTGGTCTCCCCAGG - Intergenic
1104817762 12:131658132-131658154 GAGGTGCAGCTGGTCTCCCCAGG + Intergenic
1105505332 13:21004972-21004994 CTGGCTATGCTGCTTTCCCCAGG - Intronic
1106084819 13:26531952-26531974 GAGGTGATGCTGAGTACCCCTGG - Intergenic
1106669361 13:31888406-31888428 CAGGTCCTGCTGGTTCCCCCAGG + Intergenic
1106941933 13:34789613-34789635 CAGGTGAGTGTGGTTTCCCCAGG + Intergenic
1107428417 13:40316856-40316878 CTGGTGAGGCTCGTTTCTCCTGG - Intergenic
1108204365 13:48072875-48072897 CAGTGGCTGCTGGTTTTCCCTGG + Intronic
1113045694 13:106152302-106152324 CAGGTGATGAAGGTTTACTCAGG - Intergenic
1113177991 13:107588410-107588432 TAGGTCATTCTGGTTTCCCAGGG - Intronic
1114532637 14:23405203-23405225 CAGGTGAGCCTGGTGGCCCCTGG - Exonic
1115569067 14:34650162-34650184 CAGGTGATGGTGGTTTTCACTGG - Intergenic
1118984044 14:70738371-70738393 CAGGTTTTGCTGCTTTCACCTGG + Exonic
1119328379 14:73775866-73775888 CAGGTGATGCTGACAGCCCCAGG + Intronic
1122864177 14:104596097-104596119 CAGGTGCTCCTGCTTTCCTCTGG + Intronic
1122942262 14:104986642-104986664 CAAGTGCTGCTGTGTTCCCCAGG - Exonic
1124953516 15:34344585-34344607 CAGATGATACTGGTTTCCTCTGG + Intronic
1125415214 15:39445164-39445186 CAGGTAATGCTACTTTTCCCTGG - Intergenic
1126574384 15:50182884-50182906 AAGGTGCTGCTGGTGTCGCCAGG + Exonic
1130708908 15:86260186-86260208 CAAATGCTGCTGGTTTCCCCAGG - Intronic
1133805412 16:9122813-9122835 CAGGTGATCCCCTTTTCCCCAGG - Intergenic
1134113992 16:11534401-11534423 GAGGTCATGCTGGTATCACCTGG - Intergenic
1134135476 16:11673964-11673986 CAGAAGCTGCCGGTTTCCCCGGG + Intronic
1138187159 16:54985536-54985558 CAGGAGATGCTACTTTCACCAGG + Intergenic
1140481440 16:75264992-75265014 CAAGTGATCCTGGCTACCCCGGG - Intronic
1142000216 16:87660068-87660090 GAGGTGACGCTGCTTTCCCAGGG - Intronic
1142371727 16:89686427-89686449 CAGGTGAGACGGGTTCCCCCAGG - Exonic
1142442025 16:90104812-90104834 AAGGAGATGGTGGTTTCCCACGG + Intergenic
1144344006 17:14333751-14333773 CAGGTGATGTTGGGTCACCCTGG - Intronic
1145052834 17:19677088-19677110 CAGGTAATGCTGCATTCCACAGG - Exonic
1145241277 17:21242191-21242213 CAGGGCATGCTGGCTTCCCCTGG - Exonic
1145826468 17:27880709-27880731 CAGAAGACGCTGCTTTCCCCAGG + Intronic
1146124282 17:30219679-30219701 CTGGAGATGCTGGTGTCTCCTGG + Intronic
1147843403 17:43388564-43388586 CAGCTCAGCCTGGTTTCCCCTGG - Intergenic
1150284643 17:63948063-63948085 CTGGTGGTGCTGGTGCCCCCAGG - Exonic
1151470106 17:74312637-74312659 CACGTCATGCTGGCTTACCCAGG + Intronic
1151764232 17:76123970-76123992 CAGGTGAGGCTGGCTTCTCGTGG - Intergenic
1152011693 17:77722963-77722985 CCGGTGATGCTGAAGTCCCCAGG - Intergenic
1152461885 17:80445931-80445953 CAGGGTGTGCTGGTGTCCCCTGG - Intergenic
1152868291 17:82736978-82737000 CAGGTGATGCTGGGGCCCCTGGG + Intronic
1153791899 18:8586517-8586539 CAGGTGTTGCTGGATTCCCATGG + Intergenic
1154188622 18:12208836-12208858 CAGGAGATCCTGGTTCACCCAGG + Intergenic
1157091723 18:44644563-44644585 CGTGTGATGCTGGCTTCCCTTGG - Intergenic
1157424342 18:47571999-47572021 CAGGAGAGGCTGGTTTCTTCTGG - Intergenic
1160934679 19:1588322-1588344 CAGTCGAAGCTGGTTTGCCCAGG + Intronic
1162011761 19:7820837-7820859 CAGGTGCTTCTAATTTCCCCAGG - Intergenic
1163092149 19:15027736-15027758 CTGCTGTTGCTGGTTTCCCAGGG + Intergenic
1163373794 19:16917546-16917568 CAGGTGTTGCTGTGTTGCCCAGG - Intronic
1163756260 19:19108092-19108114 CAGGTGGAGCTGCTGTCCCCAGG - Intronic
1166148543 19:40853576-40853598 CAGGTTATTCTGGTTGGCCCTGG + Intronic
1166152682 19:40885361-40885383 CAGGTTATTCTGGTTGGCCCTGG + Intronic
1166177494 19:41085274-41085296 CAGGTTATTCTGGTTGGCCCTGG - Intergenic
1166586689 19:43955215-43955237 CAAGTGATGCTGGTAGCCCTGGG - Intronic
1168556865 19:57350897-57350919 GAGGTGAAGCAGGTTTCCCAGGG + Intergenic
925650366 2:6082978-6083000 CAGGTGTTGCTGGTTGGCACAGG - Intergenic
926129151 2:10290132-10290154 CGTGTGCTGCTGGTTTCCCCCGG + Intergenic
926552047 2:14312674-14312696 CAGATGAAGCTGGTTTCTCAAGG - Intergenic
927436906 2:23074344-23074366 AAGGTGATGCTGGCTCCCCTTGG - Intergenic
929881124 2:45838161-45838183 CAGGTGTCACTGGCTTCCCCAGG - Intronic
930944839 2:57061329-57061351 CTGGTGGTGCTGGTATCCACAGG - Intergenic
932521326 2:72416564-72416586 CAGGGGCTGCTGCTTTGCCCTGG + Intronic
933900562 2:86846704-86846726 CTGGTTCTGCTGGTTTCCCTGGG - Exonic
934912614 2:98273214-98273236 CAAGTGATACTGGTTTAGCCTGG + Intronic
935371320 2:102350029-102350051 CAGGTGACTTTGGTTTACCCTGG + Intronic
935779986 2:106502521-106502543 CTGGTTCTGCTGGTTTCCCTGGG + Intergenic
935980488 2:108621272-108621294 CAAGGGACGCTGCTTTCCCCTGG + Intronic
938298774 2:130195650-130195672 CAGGTGATGCTGTCATCTCCTGG + Intronic
938457947 2:131478863-131478885 CAGGTGATGCTGTCATCTCCTGG - Intronic
940154460 2:150639500-150639522 ACGGTGATGCTAGCTTCCCCTGG + Intergenic
943524543 2:188999858-188999880 CAGGTGCTGATGGTGTCCCAGGG + Exonic
948023117 2:234753493-234753515 CTGATGATGGTGGTTGCCCCTGG + Intergenic
948223300 2:236290182-236290204 GAGGGGATGCTGGTTTCACTCGG + Intergenic
1170585157 20:17728774-17728796 CAGCTGATGCTGATTGCCCCTGG - Intronic
1171212571 20:23328058-23328080 CAGGTGATGCTGAAATCCCCAGG - Intergenic
1173801042 20:45894743-45894765 TAGGTGCTGCTGGGTGCCCCTGG + Intronic
1174857805 20:54063679-54063701 CAAGTCATTCTGGTTTGCCCAGG - Intronic
1175749285 20:61484128-61484150 CAGGTGATGCTGCTTCCCAGGGG - Intronic
1175929142 20:62485410-62485432 CAGGAGACGCTGGTTTCCCTCGG - Intergenic
1179494722 21:41764332-41764354 CAGGTGAGGCTGATTTTCACTGG - Intronic
1179718044 21:43300123-43300145 CAGGTGATGATGGTTTTCCACGG + Intergenic
1179725212 21:43338161-43338183 CAGGTGCTGCTGGGATTCCCTGG - Intergenic
1180244694 21:46539187-46539209 CAGGTGATGCTGGTCACACAGGG + Intronic
1181009622 22:20032767-20032789 CAGGTGAGGCTGGGCTCCTCAGG - Intronic
1181405674 22:22683712-22683734 CAGCTGAGCCTGGTTTCCTCAGG - Intergenic
1181661305 22:24351143-24351165 CCACTGGTGCTGGTTTCCCCTGG - Intronic
1182876906 22:33700154-33700176 TAGGTGATGCTGCTGTTCCCAGG - Intronic
1183671344 22:39274586-39274608 CAGGTGATGGTGGGCTCCCCGGG - Intergenic
1184749955 22:46479548-46479570 CAGGAGATGCTGGGTTCCAGGGG + Intronic
1185210059 22:49565658-49565680 CAGGTGACGCTGGTCTCCCTGGG + Intronic
1185298342 22:50065510-50065532 CAGATGGAGCTGGTCTCCCCCGG + Intronic
949118765 3:360296-360318 CTGGTGATGTTGTCTTCCCCAGG + Exonic
949123341 3:415093-415115 CAGGTGATGCGGGTGCCCACTGG - Intergenic
949447848 3:4154299-4154321 CTGGTGAGGTTAGTTTCCCCAGG - Intronic
950333401 3:12175050-12175072 CAGGTGAGAGTGGTTTGCCCAGG + Intronic
950542541 3:13620958-13620980 CAGGTGGTGCTGGGTTCTCTGGG + Intronic
956168921 3:66417536-66417558 CAGGTCATGCTGGTCTCACATGG - Intronic
958626534 3:96632117-96632139 AAGGTATTACTGGTTTCCCCAGG + Intergenic
959429533 3:106235952-106235974 CAGATGATGGTGGGTTCCCATGG - Intergenic
960156229 3:114299535-114299557 GAAGTGAAGCTGATTTCCCCAGG - Intronic
963732128 3:148984876-148984898 CAGGTCTTGCTTGTGTCCCCAGG - Intergenic
966721977 3:183072550-183072572 CAGGTGAAGCTGTCTTCCTCTGG + Intronic
967769783 3:193321812-193321834 AAGGTGATGATGGCTTCCACTGG + Exonic
968362293 3:198155778-198155800 AAGGAGATGGTGGTTTCCCACGG + Intergenic
969397775 4:6933876-6933898 GAGGTGATGATGGCTTCACCTGG + Intronic
969573423 4:8023234-8023256 CACGGGATTCGGGTTTCCCCGGG + Intronic
970225374 4:13851744-13851766 CAGCTGCTGCTGGATGCCCCTGG - Intergenic
970440120 4:16073616-16073638 GAGGTAATGCTGGTCTGCCCTGG + Intronic
970949812 4:21741525-21741547 TAGATGATGCTGGGTTCCACTGG - Intronic
971318223 4:25584749-25584771 CAGGAGATTCTGGTCTTCCCAGG - Intergenic
972390433 4:38608128-38608150 CAGGTGATGCTGGTGTCCTGGGG - Intergenic
972653363 4:41041830-41041852 CAGTTGTTGGTGTTTTCCCCTGG - Intronic
977071680 4:92397921-92397943 CAAGTGATTCTAGTTTCCCCAGG - Intronic
977361915 4:96016170-96016192 GAGGTGATCCTGGATTACCCAGG + Intergenic
977816666 4:101421604-101421626 CAGCTGCGGCTGCTTTCCCCAGG + Intronic
978706595 4:111720393-111720415 CATGTGCTGGTGTTTTCCCCTGG + Intergenic
980209164 4:129763678-129763700 CAGGTGAAGCTGCTATCCACAGG - Intergenic
981511592 4:145564298-145564320 CAGATGTTGCTGATTTGCCCTGG - Intergenic
995260744 5:110101545-110101567 CAGGGGATTCTTGTTTCCCAGGG + Intergenic
1003269140 6:4591894-4591916 GGGGTGATGCTGGTTTGCCTGGG - Intergenic
1004269867 6:14185519-14185541 GAGGTGATCCTGGTTTACCCAGG + Intergenic
1005031380 6:21512190-21512212 CAGGTGATGCGCCTTCCCCCTGG - Intergenic
1005137023 6:22580843-22580865 CAGTTGAAGCTGGATGCCCCAGG - Intergenic
1006035722 6:31210271-31210293 CAGTTTATGCTGGGTTCCCAAGG - Intergenic
1006235586 6:32628080-32628102 CAGATGATGCTGCTTCCCACCGG - Intergenic
1006422866 6:33946257-33946279 CCAGTGAGGCTGGTTTCACCTGG + Intergenic
1006731657 6:36240459-36240481 CTGGTGAAACTGGTTTCCTCTGG - Intergenic
1007176272 6:39899831-39899853 TAGGTGATGCTGCTGGCCCCAGG + Intronic
1007244576 6:40451499-40451521 CAGAAGATGCTGCTTCCCCCAGG - Intronic
1009930020 6:70165955-70165977 CAGGTGGTCCGGGTTTCCCAGGG - Exonic
1010221544 6:73452535-73452557 CAGGTCTTGCTGGGTTGCCCAGG - Intergenic
1012574615 6:100777983-100778005 AAGGTGATGCTGGTTTATACTGG + Intronic
1013301308 6:108807546-108807568 CTGGCAATGCTGGTTGCCCCTGG - Intergenic
1017418119 6:154243517-154243539 GAGGTGAGGCTGGTCTTCCCAGG + Intronic
1017817921 6:158028424-158028446 CAGGTGATTCTGATGCCCCCAGG - Intronic
1017900338 6:158714002-158714024 CAGGTGCTGTGGCTTTCCCCAGG - Intronic
1018889749 6:167975372-167975394 CAGGTGATGCTGGGTTCCCCAGG - Intergenic
1019076989 6:169395669-169395691 TAGATGAGGCTGGTTTCACCTGG - Intergenic
1019253386 7:32929-32951 AAGGAGATGGTGGTTTCCCACGG - Intergenic
1019340772 7:507822-507844 CAGGTGTGGCTGGGTCCCCCTGG - Intronic
1021408189 7:20298559-20298581 CAGGGGATTCTTCTTTCCCCTGG + Intergenic
1021893509 7:25211428-25211450 CAGGTCTTGCTGTGTTCCCCAGG - Intergenic
1023756183 7:43419147-43419169 CTGGTGGTGCTGGTTGCCCCAGG + Intronic
1023851470 7:44152577-44152599 CAGTTGACACTGGTGTCCCCAGG - Intronic
1023888400 7:44376371-44376393 CAGGTGTTGGTGGCTTCCACTGG + Intergenic
1024588483 7:50860870-50860892 CATGTTATGCTGGTTTGACCTGG - Intergenic
1029767013 7:102632067-102632089 CATGTGAGGCTGGCTTCTCCAGG - Intronic
1032769414 7:135034684-135034706 CAAGAGCTGTTGGTTTCCCCTGG - Exonic
1032828741 7:135599701-135599723 CAAGTGTTGCTGCTTTTCCCTGG + Intronic
1033426770 7:141251840-141251862 CAGGTGCTGCTGAAATCCCCAGG - Intronic
1035643344 8:1200146-1200168 CAGGAGAGGCTGGGTTTCCCTGG + Intergenic
1036615824 8:10386679-10386701 CAGGTGATGCTGCTGATCCCAGG + Intronic
1038250403 8:25898746-25898768 CAGGTGATTCAGGTTGTCCCTGG - Intronic
1041348000 8:56921176-56921198 CAGGTGATGTTGGTGCACCCTGG - Intergenic
1043684915 8:83072782-83072804 CAGTTTATGCTGGATTCCCAAGG - Intergenic
1044865694 8:96569033-96569055 AAGGTCTTGCTGTTTTCCCCAGG + Intronic
1046653864 8:116872454-116872476 CTGGTGATACTGGTTACCTCTGG + Intronic
1047991815 8:130294326-130294348 AAGGTGACACTGATTTCCCCTGG + Intronic
1049319520 8:141988568-141988590 AAGGTGAGGTTTGTTTCCCCAGG + Intergenic
1049433095 8:142574291-142574313 CAGGTGATGCTGGGGTGACCTGG + Intergenic
1049515837 8:143054824-143054846 CAGTTTATGCTGGATTCCCAAGG - Intronic
1050339101 9:4617994-4618016 AAGGGGATGCTGATTTCCACGGG - Exonic
1050388623 9:5113961-5113983 CAGGTGATGCTGATGGCACCTGG - Intronic
1051762490 9:20483034-20483056 CAAGTGATTCTGGCTTCTCCAGG + Intronic
1057231861 9:93325939-93325961 AAGGGGATGCTTATTTCCCCAGG - Intronic
1057911854 9:99025791-99025813 CAGGTGAGGCTGGTGGGCCCAGG - Intronic
1060092560 9:120756150-120756172 CAGGTGATGCTGATGTTTCCAGG + Intronic
1060523235 9:124306160-124306182 CAAGTGAGGCTGCTTTCCCCTGG - Intronic
1061006914 9:127933425-127933447 CATGTGATGCTGGGCTCCTCAGG - Intergenic
1062424153 9:136498300-136498322 CAGCTGCTGTTGGTTTCCCCTGG - Intronic
1062746984 9:138219440-138219462 AAGGAGATGGTGGTTTCCCACGG + Intergenic
1186350062 X:8731698-8731720 CGGCTGATCCTGGCTTCCCCTGG - Intronic
1187372906 X:18725380-18725402 CAGCTGGTGCTGGTATCTCCGGG + Intronic
1189578507 X:42381299-42381321 CATTTGATGCAGGTTACCCCTGG + Intergenic
1190080639 X:47354496-47354518 CTGGTGATGCCTGTTTGCCCCGG + Intergenic
1190262027 X:48803214-48803236 CAGGTGAGGCTGGGTCCTCCAGG + Exonic
1190314570 X:49142190-49142212 CAGGTGCTGCAGGTTTTACCTGG + Intergenic
1190535398 X:51421380-51421402 CAGTTTATGCTGGCTTCCCAAGG - Intergenic
1191629761 X:63310673-63310695 CAGGTCATGTTTTTTTCCCCTGG + Intergenic
1193095607 X:77545255-77545277 CAGCTCATGCTGGTTTGCCATGG - Intronic
1195155168 X:102115776-102115798 CAGGTGAGCAGGGTTTCCCCAGG - Intergenic
1197748687 X:129950459-129950481 GAGATGATGCTGGATTCCCAGGG + Intergenic
1198363834 X:135921701-135921723 CAGTTTATGCTGGATTCCCAAGG + Intergenic
1199314661 X:146363090-146363112 CCTGTGGTGCTGGTATCCCCAGG - Intergenic
1201683719 Y:16678356-16678378 GAGGTTATGCTTGTTTCTCCAGG - Intergenic