ID: 1075966244

View in Genome Browser
Species Human (GRCh38)
Location 10:126614212-126614234
Sequence TCCCCCTGCCCACTTTCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075966239_1075966244 9 Left 1075966239 10:126614180-126614202 CCTTAAAGGTCATTGCACTGAGC 0: 1
1: 1
2: 1
3: 6
4: 89
Right 1075966244 10:126614212-126614234 TCCCCCTGCCCACTTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075966244 Original CRISPR TCCCCCTGCCCACTTTCCCA AGG Intronic
No off target data available for this crispr