ID: 1075975176

View in Genome Browser
Species Human (GRCh38)
Location 10:126688171-126688193
Sequence CCCGGATTGTGCACTGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075975168_1075975176 9 Left 1075975168 10:126688139-126688161 CCCCAGATGTGCAAGCTGAACTT No data
Right 1075975176 10:126688171-126688193 CCCGGATTGTGCACTGCTGCTGG No data
1075975169_1075975176 8 Left 1075975169 10:126688140-126688162 CCCAGATGTGCAAGCTGAACTTC No data
Right 1075975176 10:126688171-126688193 CCCGGATTGTGCACTGCTGCTGG No data
1075975170_1075975176 7 Left 1075975170 10:126688141-126688163 CCAGATGTGCAAGCTGAACTTCC No data
Right 1075975176 10:126688171-126688193 CCCGGATTGTGCACTGCTGCTGG No data
1075975167_1075975176 26 Left 1075975167 10:126688122-126688144 CCAGGCACAGTTCTAGGCCCCAG No data
Right 1075975176 10:126688171-126688193 CCCGGATTGTGCACTGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075975176 Original CRISPR CCCGGATTGTGCACTGCTGC TGG Intergenic
No off target data available for this crispr