ID: 1075975510

View in Genome Browser
Species Human (GRCh38)
Location 10:126690677-126690699
Sequence ATTCAGTGGAAGGCTGGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075975510_1075975517 29 Left 1075975510 10:126690677-126690699 CCTTGACCAGCCTTCCACTGAAT No data
Right 1075975517 10:126690729-126690751 CATTTTTACATAAACAGTAGGGG No data
1075975510_1075975516 28 Left 1075975510 10:126690677-126690699 CCTTGACCAGCCTTCCACTGAAT No data
Right 1075975516 10:126690728-126690750 GCATTTTTACATAAACAGTAGGG 0: 10
1: 76
2: 97
3: 68
4: 340
1075975510_1075975514 -7 Left 1075975510 10:126690677-126690699 CCTTGACCAGCCTTCCACTGAAT No data
Right 1075975514 10:126690693-126690715 ACTGAATACACAATTTAGTCTGG 0: 41
1: 63
2: 47
3: 40
4: 372
1075975510_1075975515 27 Left 1075975510 10:126690677-126690699 CCTTGACCAGCCTTCCACTGAAT No data
Right 1075975515 10:126690727-126690749 TGCATTTTTACATAAACAGTAGG 0: 12
1: 79
2: 90
3: 87
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075975510 Original CRISPR ATTCAGTGGAAGGCTGGTCA AGG (reversed) Intergenic
No off target data available for this crispr