ID: 1075977057

View in Genome Browser
Species Human (GRCh38)
Location 10:126705223-126705245
Sequence CTGCAGGAATAAAGTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075977057_1075977065 16 Left 1075977057 10:126705223-126705245 CCTTGCTCACTTTATTCCTGCAG No data
Right 1075977065 10:126705262-126705284 TCTCCAGAGGGTAAGGGAGGAGG No data
1075977057_1075977064 13 Left 1075977057 10:126705223-126705245 CCTTGCTCACTTTATTCCTGCAG No data
Right 1075977064 10:126705259-126705281 CTCTCTCCAGAGGGTAAGGGAGG No data
1075977057_1075977060 3 Left 1075977057 10:126705223-126705245 CCTTGCTCACTTTATTCCTGCAG No data
Right 1075977060 10:126705249-126705271 ACGAGAGCTGCTCTCTCCAGAGG No data
1075977057_1075977062 9 Left 1075977057 10:126705223-126705245 CCTTGCTCACTTTATTCCTGCAG No data
Right 1075977062 10:126705255-126705277 GCTGCTCTCTCCAGAGGGTAAGG No data
1075977057_1075977063 10 Left 1075977057 10:126705223-126705245 CCTTGCTCACTTTATTCCTGCAG No data
Right 1075977063 10:126705256-126705278 CTGCTCTCTCCAGAGGGTAAGGG No data
1075977057_1075977061 4 Left 1075977057 10:126705223-126705245 CCTTGCTCACTTTATTCCTGCAG No data
Right 1075977061 10:126705250-126705272 CGAGAGCTGCTCTCTCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075977057 Original CRISPR CTGCAGGAATAAAGTGAGCA AGG (reversed) Intergenic
No off target data available for this crispr