ID: 1075977069

View in Genome Browser
Species Human (GRCh38)
Location 10:126705291-126705313
Sequence CACTGACCTGTTGGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075977069_1075977073 -8 Left 1075977069 10:126705291-126705313 CCAGCTTCTCCAACAGGTCAGTG No data
Right 1075977073 10:126705306-126705328 GGTCAGTGTGGTCACCTTTTGGG No data
1075977069_1075977072 -9 Left 1075977069 10:126705291-126705313 CCAGCTTCTCCAACAGGTCAGTG No data
Right 1075977072 10:126705305-126705327 AGGTCAGTGTGGTCACCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075977069 Original CRISPR CACTGACCTGTTGGAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr