ID: 1075977912

View in Genome Browser
Species Human (GRCh38)
Location 10:126712814-126712836
Sequence GTTCCTAATGGGCCACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075977912_1075977916 -7 Left 1075977912 10:126712814-126712836 CCAGTTTGTGGCCCATTAGGAAC No data
Right 1075977916 10:126712830-126712852 TAGGAACCAGGCCGCACAGCAGG 0: 80
1: 492
2: 999
3: 1292
4: 1266
1075977912_1075977919 3 Left 1075977912 10:126712814-126712836 CCAGTTTGTGGCCCATTAGGAAC No data
Right 1075977919 10:126712840-126712862 GCCGCACAGCAGGAGGTGAGTGG 0: 119
1: 705
2: 841
3: 657
4: 644
1075977912_1075977921 6 Left 1075977912 10:126712814-126712836 CCAGTTTGTGGCCCATTAGGAAC No data
Right 1075977921 10:126712843-126712865 GCACAGCAGGAGGTGAGTGGTGG 0: 133
1: 332
2: 538
3: 694
4: 925
1075977912_1075977922 7 Left 1075977912 10:126712814-126712836 CCAGTTTGTGGCCCATTAGGAAC No data
Right 1075977922 10:126712844-126712866 CACAGCAGGAGGTGAGTGGTGGG 0: 158
1: 535
2: 883
3: 1180
4: 1272
1075977912_1075977917 -4 Left 1075977912 10:126712814-126712836 CCAGTTTGTGGCCCATTAGGAAC No data
Right 1075977917 10:126712833-126712855 GAACCAGGCCGCACAGCAGGAGG 0: 72
1: 474
2: 923
3: 1250
4: 1337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075977912 Original CRISPR GTTCCTAATGGGCCACAAAC TGG (reversed) Intergenic
No off target data available for this crispr