ID: 1075979239

View in Genome Browser
Species Human (GRCh38)
Location 10:126722665-126722687
Sequence CACCACCCCCTAGTGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075979239_1075979248 7 Left 1075979239 10:126722665-126722687 CCCAGCTGCACTAGGGGGTGGTG No data
Right 1075979248 10:126722695-126722717 GAAGATGGAGAATCAGAGGAGGG No data
1075979239_1075979249 23 Left 1075979239 10:126722665-126722687 CCCAGCTGCACTAGGGGGTGGTG No data
Right 1075979249 10:126722711-126722733 AGGAGGGAACAGCATGTGCCAGG No data
1075979239_1075979245 -8 Left 1075979239 10:126722665-126722687 CCCAGCTGCACTAGGGGGTGGTG No data
Right 1075979245 10:126722680-126722702 GGGTGGTGGGTGGTGGAAGATGG No data
1075979239_1075979246 3 Left 1075979239 10:126722665-126722687 CCCAGCTGCACTAGGGGGTGGTG No data
Right 1075979246 10:126722691-126722713 GGTGGAAGATGGAGAATCAGAGG No data
1075979239_1075979247 6 Left 1075979239 10:126722665-126722687 CCCAGCTGCACTAGGGGGTGGTG No data
Right 1075979247 10:126722694-126722716 GGAAGATGGAGAATCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075979239 Original CRISPR CACCACCCCCTAGTGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr