ID: 1075982288

View in Genome Browser
Species Human (GRCh38)
Location 10:126750462-126750484
Sequence TAATCCAGGAATGCCACTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075982288_1075982292 -5 Left 1075982288 10:126750462-126750484 CCAGTAGTGGCATTCCTGGATTA No data
Right 1075982292 10:126750480-126750502 GATTAAAGGGTAGCTCTTTAAGG 0: 2
1: 0
2: 1
3: 13
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075982288 Original CRISPR TAATCCAGGAATGCCACTAC TGG (reversed) Intergenic
No off target data available for this crispr