ID: 1075985776

View in Genome Browser
Species Human (GRCh38)
Location 10:126783960-126783982
Sequence GAGCAAGGGGCCTTAGCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985776_1075985780 5 Left 1075985776 10:126783960-126783982 CCTGAGGCTAAGGCCCCTTGCTC No data
Right 1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985776 Original CRISPR GAGCAAGGGGCCTTAGCCTC AGG (reversed) Intergenic
No off target data available for this crispr