ID: 1075985779

View in Genome Browser
Species Human (GRCh38)
Location 10:126783975-126783997
Sequence AGTCATGGGTGTTTAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985779_1075985780 -10 Left 1075985779 10:126783975-126783997 CCTTGCTCTAAACACCCATGACT No data
Right 1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG No data
1075985779_1075985786 23 Left 1075985779 10:126783975-126783997 CCTTGCTCTAAACACCCATGACT No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985779_1075985787 27 Left 1075985779 10:126783975-126783997 CCTTGCTCTAAACACCCATGACT No data
Right 1075985787 10:126784025-126784047 ACCTCCTCTACATTTCTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985779 Original CRISPR AGTCATGGGTGTTTAGAGCA AGG (reversed) Intergenic
No off target data available for this crispr