ID: 1075985780

View in Genome Browser
Species Human (GRCh38)
Location 10:126783988-126784010
Sequence ACCCATGACTCACCACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985779_1075985780 -10 Left 1075985779 10:126783975-126783997 CCTTGCTCTAAACACCCATGACT No data
Right 1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG No data
1075985776_1075985780 5 Left 1075985776 10:126783960-126783982 CCTGAGGCTAAGGCCCCTTGCTC No data
Right 1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG No data
1075985777_1075985780 -8 Left 1075985777 10:126783973-126783995 CCCCTTGCTCTAAACACCCATGA No data
Right 1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG No data
1075985778_1075985780 -9 Left 1075985778 10:126783974-126783996 CCCTTGCTCTAAACACCCATGAC No data
Right 1075985780 10:126783988-126784010 ACCCATGACTCACCACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985780 Original CRISPR ACCCATGACTCACCACCCAC TGG Intergenic
No off target data available for this crispr