ID: 1075985781

View in Genome Browser
Species Human (GRCh38)
Location 10:126783989-126784011
Sequence ACCAGTGGGTGGTGAGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985781_1075985791 28 Left 1075985781 10:126783989-126784011 CCCATGACTCACCACCCACTGGT No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985781_1075985790 27 Left 1075985781 10:126783989-126784011 CCCATGACTCACCACCCACTGGT No data
Right 1075985790 10:126784039-126784061 TCTGGATGGTTCCTCTCTCTAGG No data
1075985781_1075985787 13 Left 1075985781 10:126783989-126784011 CCCATGACTCACCACCCACTGGT No data
Right 1075985787 10:126784025-126784047 ACCTCCTCTACATTTCTGGATGG No data
1075985781_1075985786 9 Left 1075985781 10:126783989-126784011 CCCATGACTCACCACCCACTGGT No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985781 Original CRISPR ACCAGTGGGTGGTGAGTCAT GGG (reversed) Intergenic
No off target data available for this crispr