ID: 1075985783

View in Genome Browser
Species Human (GRCh38)
Location 10:126784000-126784022
Sequence TTTTAGAGTGTACCAGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985783_1075985787 2 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985787 10:126784025-126784047 ACCTCCTCTACATTTCTGGATGG No data
1075985783_1075985790 16 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985790 10:126784039-126784061 TCTGGATGGTTCCTCTCTCTAGG No data
1075985783_1075985793 23 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985793 10:126784046-126784068 GGTTCCTCTCTCTAGGGTCTGGG No data
1075985783_1075985786 -2 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985783_1075985791 17 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985783_1075985792 22 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985792 10:126784045-126784067 TGGTTCCTCTCTCTAGGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985783 Original CRISPR TTTTAGAGTGTACCAGTGGG TGG (reversed) Intergenic
No off target data available for this crispr