ID: 1075985786

View in Genome Browser
Species Human (GRCh38)
Location 10:126784021-126784043
Sequence AATCACCTCCTCTACATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985779_1075985786 23 Left 1075985779 10:126783975-126783997 CCTTGCTCTAAACACCCATGACT No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985777_1075985786 25 Left 1075985777 10:126783973-126783995 CCCCTTGCTCTAAACACCCATGA No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985778_1075985786 24 Left 1075985778 10:126783974-126783996 CCCTTGCTCTAAACACCCATGAC No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985782_1075985786 8 Left 1075985782 10:126783990-126784012 CCATGACTCACCACCCACTGGTA No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985781_1075985786 9 Left 1075985781 10:126783989-126784011 CCCATGACTCACCACCCACTGGT No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985785_1075985786 -6 Left 1075985785 10:126784004-126784026 CCACTGGTACACTCTAAAATCAC No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985783_1075985786 -2 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data
1075985784_1075985786 -5 Left 1075985784 10:126784003-126784025 CCCACTGGTACACTCTAAAATCA No data
Right 1075985786 10:126784021-126784043 AATCACCTCCTCTACATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985786 Original CRISPR AATCACCTCCTCTACATTTC TGG Intergenic
No off target data available for this crispr