ID: 1075985791

View in Genome Browser
Species Human (GRCh38)
Location 10:126784040-126784062
Sequence CTGGATGGTTCCTCTCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985781_1075985791 28 Left 1075985781 10:126783989-126784011 CCCATGACTCACCACCCACTGGT No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985785_1075985791 13 Left 1075985785 10:126784004-126784026 CCACTGGTACACTCTAAAATCAC No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985783_1075985791 17 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985782_1075985791 27 Left 1075985782 10:126783990-126784012 CCATGACTCACCACCCACTGGTA No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985788_1075985791 -9 Left 1075985788 10:126784026-126784048 CCTCCTCTACATTTCTGGATGGT No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data
1075985784_1075985791 14 Left 1075985784 10:126784003-126784025 CCCACTGGTACACTCTAAAATCA No data
Right 1075985791 10:126784040-126784062 CTGGATGGTTCCTCTCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985791 Original CRISPR CTGGATGGTTCCTCTCTCTA GGG Intergenic
No off target data available for this crispr