ID: 1075985793

View in Genome Browser
Species Human (GRCh38)
Location 10:126784046-126784068
Sequence GGTTCCTCTCTCTAGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075985784_1075985793 20 Left 1075985784 10:126784003-126784025 CCCACTGGTACACTCTAAAATCA No data
Right 1075985793 10:126784046-126784068 GGTTCCTCTCTCTAGGGTCTGGG No data
1075985783_1075985793 23 Left 1075985783 10:126784000-126784022 CCACCCACTGGTACACTCTAAAA No data
Right 1075985793 10:126784046-126784068 GGTTCCTCTCTCTAGGGTCTGGG No data
1075985789_1075985793 -6 Left 1075985789 10:126784029-126784051 CCTCTACATTTCTGGATGGTTCC No data
Right 1075985793 10:126784046-126784068 GGTTCCTCTCTCTAGGGTCTGGG No data
1075985788_1075985793 -3 Left 1075985788 10:126784026-126784048 CCTCCTCTACATTTCTGGATGGT No data
Right 1075985793 10:126784046-126784068 GGTTCCTCTCTCTAGGGTCTGGG No data
1075985785_1075985793 19 Left 1075985785 10:126784004-126784026 CCACTGGTACACTCTAAAATCAC No data
Right 1075985793 10:126784046-126784068 GGTTCCTCTCTCTAGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075985793 Original CRISPR GGTTCCTCTCTCTAGGGTCT GGG Intergenic
No off target data available for this crispr