ID: 1075987893

View in Genome Browser
Species Human (GRCh38)
Location 10:126803809-126803831
Sequence GAGGGGAAAGGGAAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075987893_1075987900 -6 Left 1075987893 10:126803809-126803831 CCTGCCTCCTTCCCTTTCCCCTC No data
Right 1075987900 10:126803826-126803848 CCCCTCACCGTTGTTGCCCTGGG No data
1075987893_1075987898 -7 Left 1075987893 10:126803809-126803831 CCTGCCTCCTTCCCTTTCCCCTC No data
Right 1075987898 10:126803825-126803847 TCCCCTCACCGTTGTTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075987893 Original CRISPR GAGGGGAAAGGGAAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr