ID: 1075990162

View in Genome Browser
Species Human (GRCh38)
Location 10:126830307-126830329
Sequence CACAGCTAACATCTTACTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075990161_1075990162 -7 Left 1075990161 10:126830291-126830313 CCAAGTATGACAAACACACAGCT No data
Right 1075990162 10:126830307-126830329 CACAGCTAACATCTTACTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075990162 Original CRISPR CACAGCTAACATCTTACTGA TGG Intergenic
No off target data available for this crispr