ID: 1075997516

View in Genome Browser
Species Human (GRCh38)
Location 10:126890607-126890629
Sequence CGGCAGGCAAGGGGCGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997516_1075997530 13 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997516_1075997529 12 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997529 10:126890642-126890664 AAGTCAGGGACCCCAAACGGAGG No data
1075997516_1075997526 -3 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997526 10:126890627-126890649 CCGTTCTGTTGCGGGAAGTCAGG No data
1075997516_1075997534 30 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997534 10:126890660-126890682 GGAGGGACCAGCTGAAGCCATGG No data
1075997516_1075997527 -2 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997527 10:126890628-126890650 CGTTCTGTTGCGGGAAGTCAGGG No data
1075997516_1075997528 9 Left 1075997516 10:126890607-126890629 CCTCACCCGCCCCTTGCCTGCCG No data
Right 1075997528 10:126890639-126890661 GGGAAGTCAGGGACCCCAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997516 Original CRISPR CGGCAGGCAAGGGGCGGGTG AGG (reversed) Intergenic