ID: 1075997519

View in Genome Browser
Species Human (GRCh38)
Location 10:126890616-126890638
Sequence GCAACAGAACGGCAGGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075997519_1075997534 21 Left 1075997519 10:126890616-126890638 CCCCTTGCCTGCCGTTCTGTTGC No data
Right 1075997534 10:126890660-126890682 GGAGGGACCAGCTGAAGCCATGG No data
1075997519_1075997528 0 Left 1075997519 10:126890616-126890638 CCCCTTGCCTGCCGTTCTGTTGC No data
Right 1075997528 10:126890639-126890661 GGGAAGTCAGGGACCCCAAACGG No data
1075997519_1075997530 4 Left 1075997519 10:126890616-126890638 CCCCTTGCCTGCCGTTCTGTTGC No data
Right 1075997530 10:126890643-126890665 AGTCAGGGACCCCAAACGGAGGG No data
1075997519_1075997529 3 Left 1075997519 10:126890616-126890638 CCCCTTGCCTGCCGTTCTGTTGC No data
Right 1075997529 10:126890642-126890664 AAGTCAGGGACCCCAAACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075997519 Original CRISPR GCAACAGAACGGCAGGCAAG GGG (reversed) Intergenic